EMAIL THIS PAGE TO A FRIEND

SSX8

synovial sarcoma, X breakpoint 8

Species: Human SSX8(280659)
UniProtKB ID: Q7RTT4, A6NJM6
Gene ID:
4 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51719 Anti-SSX8 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174961 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104351 predicted 161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174961
SSX8 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174961.2-638s1c1
Sequence:CCGGCCTGAGGAAGATGATGAGTAACTCGAGTTACTCATCATCTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-122s1c1
Sequence:CCGGCCAGGGATGATGATAAAGCATCTCGAGATGCTTTATCATCATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-162s1c1
Sequence:CCGGCTTCAATGATATTGCCACATACTCGAGTATGTGGCAATATCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-402s1c1
Sequence:CCGGCCAGAGAATCATCCCGAAGATCTCGAGATCTTCGGGATGATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-230s1c1
Sequence:CCGGGCTATGTGTATATGAAGAGAACTCGAGTTCTCTTCATATACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174961
SSX8 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174961.2-638s1c1
Sequence:CCGGCCTGAGGAAGATGATGAGTAACTCGAGTTACTCATCATCTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-122s1c1
Sequence:CCGGCCAGGGATGATGATAAAGCATCTCGAGATGCTTTATCATCATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-162s1c1
Sequence:CCGGCTTCAATGATATTGCCACATACTCGAGTATGTGGCAATATCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-402s1c1
Sequence:CCGGCCAGAGAATCATCCCGAAGATCTCGAGATCTTCGGGATGATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-230s1c1
Sequence:CCGGGCTATGTGTATATGAAGAGAACTCGAGTTCTCTTCATATACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174961
SSX8 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174961.2-638s1c1
Sequence:CCGGCCTGAGGAAGATGATGAGTAACTCGAGTTACTCATCATCTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-122s1c1
Sequence:CCGGCCAGGGATGATGATAAAGCATCTCGAGATGCTTTATCATCATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-162s1c1
Sequence:CCGGCTTCAATGATATTGCCACATACTCGAGTATGTGGCAATATCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-402s1c1
Sequence:CCGGCCAGAGAATCATCCCGAAGATCTCGAGATCTTCGGGATGATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174961.2-230s1c1
Sequence:CCGGGCTATGTGTATATGAAGAGAACTCGAGTTCTCTTCATATACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks