EMAIL THIS PAGE TO A FRIEND

SSX9

synovial sarcoma, X breakpoint 9

UniProtKB ID: Q7RTT3
Gene ID:
Mouse(382206) synovial sarcoma, X breakpoint 9
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412943 Anti-SSX9 antibody produced in mouse purified immunoglobulin, 1 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174962 Rosetta Predictions human pricing
NM_199063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023996 predicted 436
2 SASI_Hs01_00023997 predicted 458
3 SASI_Hs01_00023998 predicted 615
4 SASI_Hs01_00023999 predicted 455
5 SASI_Hs01_00024000 predicted 444
6 SASI_Hs01_00024001 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130506 predicted 215
2 SASI_Mm01_00130507 predicted 218
3 SASI_Mm01_00130508 predicted 310
4 SASI_Mm01_00130510 predicted 307
5 SASI_Mm01_00130502 predicted 372
6 SASI_Mm01_00130503 predicted 366
7 SASI_Mm01_00130504 predicted 374
8 SASI_Mm01_00130505 predicted 367
9 SASI_Mm01_00130509 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174962
SSX9 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174962.2-654s1c1
Sequence:CCGGGCCCATGATGAGAAGCAGAATCTCGAGATTCTGCTTCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-262s1c1
Sequence:CCGGCTCCCACCTTTCATGTGTAATCTCGAGATTACACATGAAAGGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-409s1c1
Sequence:CCGGCCAGCAGAGGTAGGAAATGATCTCGAGATCATTTCCTACCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-135s1c1
Sequence:CCGGCTTCGATGATATTGCCAAATACTCGAGTATTTGGCAATATCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-261s1c1
Sequence:CCGGCCTCCCACCTTTCATGTGTAACTCGAGTTACACATGAAAGGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174962.3-849s21c1
Sequence:CCGGTATAGTGTGCAATTCTGTTAGCTCGAGCTAACAGAATTGCACACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174962.3-117s21c1
Sequence:CCGGACCTAGGGCTGGTTCTCAAATCTCGAGATTTGAGAACCAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174962.3-824s21c1
Sequence:CCGGTGTTAGTGTTTCCGTTGTATTCTCGAGAATACAACGGAAACACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174962.3-370s21c1
Sequence:CCGGGAACGTTCTCAGATGACTTTCCTCGAGGAAAGTCATCTGAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174962
SSX9 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174962.2-654s1c1
Sequence:CCGGGCCCATGATGAGAAGCAGAATCTCGAGATTCTGCTTCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-262s1c1
Sequence:CCGGCTCCCACCTTTCATGTGTAATCTCGAGATTACACATGAAAGGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-409s1c1
Sequence:CCGGCCAGCAGAGGTAGGAAATGATCTCGAGATCATTTCCTACCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-135s1c1
Sequence:CCGGCTTCGATGATATTGCCAAATACTCGAGTATTTGGCAATATCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-261s1c1
Sequence:CCGGCCTCCCACCTTTCATGTGTAACTCGAGTTACACATGAAAGGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174962.3-849s21c1
Sequence:CCGGTATAGTGTGCAATTCTGTTAGCTCGAGCTAACAGAATTGCACACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174962.3-117s21c1
Sequence:CCGGACCTAGGGCTGGTTCTCAAATCTCGAGATTTGAGAACCAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174962.3-824s21c1
Sequence:CCGGTGTTAGTGTTTCCGTTGTATTCTCGAGAATACAACGGAAACACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174962.3-370s21c1
Sequence:CCGGGAACGTTCTCAGATGACTTTCCTCGAGGAAAGTCATCTGAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174962
SSX9 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174962.2-654s1c1
Sequence:CCGGGCCCATGATGAGAAGCAGAATCTCGAGATTCTGCTTCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-262s1c1
Sequence:CCGGCTCCCACCTTTCATGTGTAATCTCGAGATTACACATGAAAGGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-409s1c1
Sequence:CCGGCCAGCAGAGGTAGGAAATGATCTCGAGATCATTTCCTACCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-135s1c1
Sequence:CCGGCTTCGATGATATTGCCAAATACTCGAGTATTTGGCAATATCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174962.2-261s1c1
Sequence:CCGGCCTCCCACCTTTCATGTGTAACTCGAGTTACACATGAAAGGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174962.3-849s21c1
Sequence:CCGGTATAGTGTGCAATTCTGTTAGCTCGAGCTAACAGAATTGCACACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174962.3-117s21c1
Sequence:CCGGACCTAGGGCTGGTTCTCAAATCTCGAGATTTGAGAACCAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174962.3-824s21c1
Sequence:CCGGTGTTAGTGTTTCCGTTGTATTCTCGAGAATACAACGGAAACACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174962.3-370s21c1
Sequence:CCGGGAACGTTCTCAGATGACTTTCCTCGAGGAAAGTCATCTGAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199063
SSX9 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-367s1c1
Sequence:CCGGGAAGCTGACATTGGTGACAATCTCGAGATTGTCACCAATGTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-401s1c1
Sequence:CCGGGTAGAAGAAAGACTTGCCTCTCTCGAGAGAGGCAAGTCTTTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-302s1c1
Sequence:CCGGGAAGTTCATGACAGTGATGTTCTCGAGAACATCACTGTCATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-373s1c1
Sequence:CCGGGACATTGGTGACAATAAGTATCTCGAGATACTTATTGTCACCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199063
SSX9 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-367s1c1
Sequence:CCGGGAAGCTGACATTGGTGACAATCTCGAGATTGTCACCAATGTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-401s1c1
Sequence:CCGGGTAGAAGAAAGACTTGCCTCTCTCGAGAGAGGCAAGTCTTTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-302s1c1
Sequence:CCGGGAAGTTCATGACAGTGATGTTCTCGAGAACATCACTGTCATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-373s1c1
Sequence:CCGGGACATTGGTGACAATAAGTATCTCGAGATACTTATTGTCACCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199063
SSX9 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-367s1c1
Sequence:CCGGGAAGCTGACATTGGTGACAATCTCGAGATTGTCACCAATGTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-401s1c1
Sequence:CCGGGTAGAAGAAAGACTTGCCTCTCTCGAGAGAGGCAAGTCTTTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-302s1c1
Sequence:CCGGGAAGTTCATGACAGTGATGTTCTCGAGAACATCACTGTCATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199063.1-373s1c1
Sequence:CCGGGACATTGGTGACAATAAGTATCTCGAGATACTTATTGTCACCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks