EMAIL THIS PAGE TO A FRIEND

ST13

suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)

Synonyms: AAG2 FAM10A1 FAM10A4 HIP HOP HSPABP HSPABP1 P48 PRO0786 SNC6
UniProtKB ID: P50502, O14999, Q2TU77
Gene ID:
Human(6767) Summary: The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Mouse(70356) suppression of tumorigenicity 13
Rat(81800) suppression of tumorigenicity 13
Zebrafish(564225) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
domestic cat(101086989) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
dog(607960) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
chicken(418003) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
cow(510494) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
sheep(101109085) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
naked mole-rat(101712834) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
domestic guinea pig(100734259) suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300340 Anti-ST13 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1400266 Anti-ST13 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA046412 Anti-ST13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA047114 Anti-ST13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA047116 Anti-ST13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043233 Anti-ST13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1402932 Monoclonal Anti-ST13 antibody produced in mouse clone 2B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300200 Monoclonal Anti-ST13 antibody produced in mouse clone 3B10, ascites fluid monkey, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AMAB91218 Monoclonal Anti-ST13 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3708, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031122 Rosetta Predictions rat pricing
NM_133726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079584 predicted 679
2 SASI_Rn01_00079585 predicted 669
3 SASI_Rn01_00079586 predicted 678
4 SASI_Rn01_00079587 predicted 668
5 SASI_Rn02_00264430 predicted 383
6 SASI_Rn01_00079588 predicted 1166
7 SASI_Rn02_00264431 predicted 757
8 SASI_Rn02_00264432 predicted 1100
9 SASI_Rn02_00264433 predicted 604
10 SASI_Rn02_00264434 predicted 604
11 SASI_Rn01_00079589 predicted 1205
12 SASI_Rn01_00079590 predicted 242
13 SASI_Rn01_00079591 predicted 145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118382 predicted 1190
2 SASI_Mm02_00338705 predicted 523
3 SASI_Mm01_00118383 predicted 227
4 SASI_Mm01_00118384 predicted 1158
5 SASI_Mm01_00118385 predicted 586
6 SASI_Mm01_00118386 predicted 715
7 SASI_Mm01_00118387 predicted 489
8 SASI_Mm01_00118390 predicted 450
9 SASI_Mm01_00118391 predicted 645
10 SASI_Mm02_00338706 predicted 899
11 SASI_Mm01_00118388 predicted 351
12 SASI_Mm01_00118389 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133726
VALIDATED
ST13 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-560s1c1
Sequence:CCGGGCCAGTGTCTTTGTCAAACTACTCGAGTAGTTTGACAAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-647s1c1
Sequence:CCGGCCATACAAATGGCGAGGGAAACTCGAGTTTCCCTCGCCATTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-1159s1c1
Sequence:CCGGCCCGAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-919s1c1
Sequence:CCGGCGGATCTCAGTATGGCTCTTTCTCGAGAAAGAGCCATACTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133726.1-455s1c1
Sequence:CCGGGCTGCCATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133726
VALIDATED
ST13 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-560s1c1
Sequence:CCGGGCCAGTGTCTTTGTCAAACTACTCGAGTAGTTTGACAAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-647s1c1
Sequence:CCGGCCATACAAATGGCGAGGGAAACTCGAGTTTCCCTCGCCATTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-1159s1c1
Sequence:CCGGCCCGAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-919s1c1
Sequence:CCGGCGGATCTCAGTATGGCTCTTTCTCGAGAAAGAGCCATACTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133726.1-455s1c1
Sequence:CCGGGCTGCCATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133726
VALIDATED
ST13 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-560s1c1
Sequence:CCGGGCCAGTGTCTTTGTCAAACTACTCGAGTAGTTTGACAAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-647s1c1
Sequence:CCGGCCATACAAATGGCGAGGGAAACTCGAGTTTCCCTCGCCATTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-1159s1c1
Sequence:CCGGCCCGAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133726.1-919s1c1
Sequence:CCGGCGGATCTCAGTATGGCTCTTTCTCGAGAAAGAGCCATACTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133726.1-455s1c1
Sequence:CCGGGCTGCCATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003932
VALIDATED
ST13 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-501s1c1
Sequence:CCGGGCTGCTATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-606s1c1
Sequence:CCGGGCCAGTGTCTTCGTCAAATTACTCGAGTAATTTGACGAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-1196s1c1
Sequence:CCGGCCCAAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-876s1c1
Sequence:CCGGCGAGAGATCAAAGAAAGAATACTCGAGTATTCTTTCTTTGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003932.3-765s1c1
Sequence:CCGGGCCTGTAAATTGGATTATGATCTCGAGATCATAATCCAATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-876s21c1
Sequence:CCGGCGAGAGATCAAAGAAAGAATACTCGAGTATTCTTTCTTTGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-1196s21c1
Sequence:CCGGCCCAAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-606s21c1
Sequence:CCGGGCCAGTGTCTTCGTCAAATTACTCGAGTAATTTGACGAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-501s21c1
Sequence:CCGGGCTGCTATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003932
VALIDATED
ST13 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-501s1c1
Sequence:CCGGGCTGCTATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-606s1c1
Sequence:CCGGGCCAGTGTCTTCGTCAAATTACTCGAGTAATTTGACGAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-1196s1c1
Sequence:CCGGCCCAAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-876s1c1
Sequence:CCGGCGAGAGATCAAAGAAAGAATACTCGAGTATTCTTTCTTTGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003932.3-765s1c1
Sequence:CCGGGCCTGTAAATTGGATTATGATCTCGAGATCATAATCCAATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-876s21c1
Sequence:CCGGCGAGAGATCAAAGAAAGAATACTCGAGTATTCTTTCTTTGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-1196s21c1
Sequence:CCGGCCCAAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-606s21c1
Sequence:CCGGGCCAGTGTCTTCGTCAAATTACTCGAGTAATTTGACGAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-501s21c1
Sequence:CCGGGCTGCTATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003932
VALIDATED
ST13 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-501s1c1
Sequence:CCGGGCTGCTATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-606s1c1
Sequence:CCGGGCCAGTGTCTTCGTCAAATTACTCGAGTAATTTGACGAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-1196s1c1
Sequence:CCGGCCCAAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003932.3-876s1c1
Sequence:CCGGCGAGAGATCAAAGAAAGAATACTCGAGTATTCTTTCTTTGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003932.3-765s1c1
Sequence:CCGGGCCTGTAAATTGGATTATGATCTCGAGATCATAATCCAATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-876s21c1
Sequence:CCGGCGAGAGATCAAAGAAAGAATACTCGAGTATTCTTTCTTTGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-1196s21c1
Sequence:CCGGCCCAAAGGTTATGAATCTCATCTCGAGATGAGATTCATAACCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-606s21c1
Sequence:CCGGGCCAGTGTCTTCGTCAAATTACTCGAGTAATTTGACGAAGACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003932.3-501s21c1
Sequence:CCGGGCTGCTATTGAAGCCCTAAATCTCGAGATTTAGGGCTTCAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks