EMAIL THIS PAGE TO A FRIEND

ST14

suppression of tumorigenicity 14 (colon carcinoma)

Synonyms: HAI MT-SP1 MTSP1 PRSS14 SNC19 TADG15 TMPRSS14
UniProtKB ID: Q9Y5Y6, Q9BS01, Q9H3S0, Q9HB36, Q9HCA3
Gene ID:
Human(6768) Summary: The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
Mouse(19143) suppression of tumorigenicity 14 (colon carcinoma)
Rat(114093) suppression of tumorigenicity 14 (colon carcinoma)
chicken(419731) suppression of tumorigenicity 14 (colon carcinoma)
dog(489278) suppression of tumorigenicity 14 (colon carcinoma)
domestic cat(101095767) suppression of tumorigenicity 14 (colon carcinoma)
domestic guinea pig(100713477) suppression of tumorigenicity 14 (colon carcinoma)
naked mole-rat(101697952) suppression of tumorigenicity 14 (colon carcinoma)
cow(767617) suppression of tumorigenicity 14 (colon carcinoma)
sheep(101119684) suppression of tumorigenicity 14 (colon carcinoma)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021978 Rosetta Predictions human pricing
NM_053635 Rosetta Predictions rat pricing
NM_011176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144187 predicted 1461
2 SASI_Hs01_00144188 predicted 1162
3 SASI_Hs01_00144189 predicted 464
4 SASI_Hs01_00144190 predicted 1312
5 SASI_Hs01_00144191 predicted 1718
6 SASI_Hs01_00144192 predicted 1508
7 SASI_Hs01_00144193 predicted 1735
8 SASI_Hs01_00144194 predicted 2530
9 SASI_Hs01_00144195 predicted 2543
10 SASI_Hs01_00144196 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031696 predicted 1193
2 SASI_Rn01_00031697 predicted 1447
3 SASI_Rn01_00031698 predicted 536
4 SASI_Rn01_00031699 predicted 678
5 SASI_Rn01_00031700 predicted 1097
6 SASI_Rn01_00031701 predicted 1061
7 SASI_Rn01_00031702 predicted 2477
8 SASI_Rn01_00031703 predicted 1235
9 SASI_Rn02_00266347 predicted 2208
10 SASI_Rn01_00031705 predicted 1385
11 SASI_Rn01_00031704 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051737 predicted 2466
2 SASI_Mm02_00320057 predicted 1148
3 SASI_Mm01_00051738 predicted 2526
4 SASI_Mm01_00051739 predicted 464
5 SASI_Mm01_00051740 predicted 576
6 SASI_Mm01_00051741 predicted 1856
7 SASI_Mm01_00051743 predicted 2127
8 SASI_Mm01_00051744 predicted 1409
9 SASI_Mm01_00051745 predicted 1492
10 SASI_Mm01_00051746 predicted 2257
11 SASI_Mm01_00051742 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021978
ST14 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 14 (colon carcinoma)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021978.3-475s21c1
Sequence:CCGGGAGGATCACAAATGAGAATTTCTCGAGAAATTCTCATTTGTGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021978.3-2167s21c1
Sequence:CCGGCATCGATGACAGAGGATTCAGCTCGAGCTGAATCCTCTGTCATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-1234s1c1
Sequence:CCGGCACCCAACATTGACTGCACATCTCGAGATGTGCAGTCAATGTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-405s1c1
Sequence:CCGGCGTGTCCAGAAGGTCTTCAATCTCGAGATTGAAGACCTTCTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-227s1c1
Sequence:CCGGGCACGAGAAAGTGAATGGCTTCTCGAGAAGCCATTCACTTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-1463s1c1
Sequence:CCGGCACCGGCTTCTTAGCTGAATACTCGAGTATTCAGCTAAGAAGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-2261s1c1
Sequence:CCGGCAATGACTTCACCTTCGACTACTCGAGTAGTCGAAGGTGAAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021978
ST14 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 14 (colon carcinoma)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021978.3-475s21c1
Sequence:CCGGGAGGATCACAAATGAGAATTTCTCGAGAAATTCTCATTTGTGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021978.3-2167s21c1
Sequence:CCGGCATCGATGACAGAGGATTCAGCTCGAGCTGAATCCTCTGTCATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-1234s1c1
Sequence:CCGGCACCCAACATTGACTGCACATCTCGAGATGTGCAGTCAATGTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-405s1c1
Sequence:CCGGCGTGTCCAGAAGGTCTTCAATCTCGAGATTGAAGACCTTCTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-227s1c1
Sequence:CCGGGCACGAGAAAGTGAATGGCTTCTCGAGAAGCCATTCACTTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-1463s1c1
Sequence:CCGGCACCGGCTTCTTAGCTGAATACTCGAGTATTCAGCTAAGAAGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-2261s1c1
Sequence:CCGGCAATGACTTCACCTTCGACTACTCGAGTAGTCGAAGGTGAAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021978
ST14 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 14 (colon carcinoma)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021978.3-475s21c1
Sequence:CCGGGAGGATCACAAATGAGAATTTCTCGAGAAATTCTCATTTGTGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021978.3-2167s21c1
Sequence:CCGGCATCGATGACAGAGGATTCAGCTCGAGCTGAATCCTCTGTCATCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-1234s1c1
Sequence:CCGGCACCCAACATTGACTGCACATCTCGAGATGTGCAGTCAATGTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-405s1c1
Sequence:CCGGCGTGTCCAGAAGGTCTTCAATCTCGAGATTGAAGACCTTCTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-227s1c1
Sequence:CCGGGCACGAGAAAGTGAATGGCTTCTCGAGAAGCCATTCACTTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-1463s1c1
Sequence:CCGGCACCGGCTTCTTAGCTGAATACTCGAGTATTCAGCTAAGAAGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021978.2-2261s1c1
Sequence:CCGGCAATGACTTCACCTTCGACTACTCGAGTAGTCGAAGGTGAAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011176
ST14 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 14 (colon carcinoma)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-291s1c1
Sequence:CCGGCCTGCGAACAATGCCAAGAAACTCGAGTTTCTTGGCATTGTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-2139s1c1
Sequence:CCGGCATTGCTTTCAGGATGACAAACTCGAGTTTGTCATCCTGAAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-1311s1c1
Sequence:CCGGGTGCGCTTCAAACTCTTCTATCTCGAGATAGAAGAGTTTGAAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-2246s1c1
Sequence:CCGGGCTGAAGCTCAAACGTATCATCTCGAGATGATACGTTTGAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-1104s1c1
Sequence:CCGGGTCTTCCTTGTCACGCTGATACTCGAGTATCAGCGTGACAAGGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011176
ST14 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 14 (colon carcinoma)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-291s1c1
Sequence:CCGGCCTGCGAACAATGCCAAGAAACTCGAGTTTCTTGGCATTGTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-2139s1c1
Sequence:CCGGCATTGCTTTCAGGATGACAAACTCGAGTTTGTCATCCTGAAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-1311s1c1
Sequence:CCGGGTGCGCTTCAAACTCTTCTATCTCGAGATAGAAGAGTTTGAAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-2246s1c1
Sequence:CCGGGCTGAAGCTCAAACGTATCATCTCGAGATGATACGTTTGAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-1104s1c1
Sequence:CCGGGTCTTCCTTGTCACGCTGATACTCGAGTATCAGCGTGACAAGGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011176
ST14 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 14 (colon carcinoma)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-291s1c1
Sequence:CCGGCCTGCGAACAATGCCAAGAAACTCGAGTTTCTTGGCATTGTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-2139s1c1
Sequence:CCGGCATTGCTTTCAGGATGACAAACTCGAGTTTGTCATCCTGAAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-1311s1c1
Sequence:CCGGGTGCGCTTCAAACTCTTCTATCTCGAGATAGAAGAGTTTGAAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-2246s1c1
Sequence:CCGGGCTGAAGCTCAAACGTATCATCTCGAGATGATACGTTTGAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011176.3-1104s1c1
Sequence:CCGGGTCTTCCTTGTCACGCTGATACTCGAGTATCAGCGTGACAAGGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks