EMAIL THIS PAGE TO A FRIEND

ST18

suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)

Synonyms: ZC2HC10 ZNF387
UniProtKB ID: O60284, Q17RY1
Gene ID:
Mouse(240690) suppression of tumorigenicity 18
Rat(266680) suppression of tumorigenicity 18
Zebrafish(569230) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Horse(100053563) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
domestic cat(101093989) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
dog(486947) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
chicken(421115) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
cow(536336) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
sheep(101106440) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
naked mole-rat(101714222) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Domestic Rabbit(100351142) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
domestic guinea pig(100718191) suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108720 Anti-ST18 affinity isolated antibody canine, rat, rat, rabbit, horse, mouse, guinea pig, human, bovine
immunohistochemistry, western blot pricing
SAB2102313 Anti-ST18 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, horse, rabbit, canine, human
western blot pricing
HPA044919 Anti-ST18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503692 Anti-ZNF387, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014682 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014682 Rosetta Predictions human pricing
NM_153310 Rosetta Predictions rat pricing
NM_173868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024827 predicted 3679
2 SASI_Hs01_00024829 predicted 2255
3 SASI_Hs01_00024830 predicted 3030
4 SASI_Hs01_00024832 predicted 3858
5 SASI_Hs01_00024833 predicted 3215
6 SASI_Hs01_00024835 predicted 1609
7 SASI_Hs01_00024836 predicted 3157
8 SASI_Hs02_00346044 predicted 2906
9 SASI_Hs02_00346045 predicted 3787
10 SASI_Hs02_00346046 predicted 1216
11 SASI_Hs01_00024828 predicted 3372
12 SASI_Hs01_00024831 predicted 2847
13 SASI_Hs01_00024834 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083942 predicted 1801
2 SASI_Rn01_00083943 predicted 511
3 SASI_Rn01_00083944 predicted 2481
4 SASI_Rn01_00083946 predicted 2595
5 SASI_Rn01_00083947 predicted 2409
6 SASI_Rn01_00083948 predicted 2271
7 SASI_Rn02_00268957 predicted 1562
8 SASI_Rn01_00083950 predicted 2743
9 SASI_Rn02_00268958 predicted 2848
10 SASI_Rn02_00268959 predicted 2094
11 SASI_Rn01_00083945 predicted 1445
12 SASI_Rn01_00083949 predicted 1670
13 SASI_Rn01_00083951 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049494 predicted 611
2 SASI_Mm01_00049495 predicted 2805
3 SASI_Mm01_00049496 predicted 3377
4 SASI_Mm02_00345464 predicted 2507
5 SASI_Mm01_00049497 predicted 3295
6 SASI_Mm01_00049498 predicted 1459
7 SASI_Mm01_00049499 predicted 1099
8 SASI_Mm01_00049500 predicted 778
9 SASI_Mm01_00049501 predicted 1298
10 SASI_Mm01_00049502 predicted 2993
11 SASI_Mm01_00049493 predicted 1423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014682
ST18 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014682.1-4498s1c1
Sequence:CCGGGCTCAGAATTTGTTAGCAATACTCGAGTATTGCTAACAAATTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-2644s1c1
Sequence:CCGGGCAGCATTCTATCAGGCTCTTCTCGAGAAGAGCCTGATAGAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-2494s1c1
Sequence:CCGGGCCGAAATAGAAGTGGATGAACTCGAGTTCATCCACTTCTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-1327s1c1
Sequence:CCGGCCACCTAGAGTCCCAAAGTATCTCGAGATACTTTGGGACTCTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-3746s1c1
Sequence:CCGGGCAATCTGGAACGGGACTATTCTCGAGAATAGTCCCGTTCCAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014682.2-3684s21c1
Sequence:CCGGCATCTATGGAGAGCAACTTAACTCGAGTTAAGTTGCTCTCCATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014682.2-2497s21c1
Sequence:CCGGCTCTTATAGCTACGGTCAATGCTCGAGCATTGACCGTAGCTATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014682
ST18 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014682.1-4498s1c1
Sequence:CCGGGCTCAGAATTTGTTAGCAATACTCGAGTATTGCTAACAAATTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-2644s1c1
Sequence:CCGGGCAGCATTCTATCAGGCTCTTCTCGAGAAGAGCCTGATAGAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-2494s1c1
Sequence:CCGGGCCGAAATAGAAGTGGATGAACTCGAGTTCATCCACTTCTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-1327s1c1
Sequence:CCGGCCACCTAGAGTCCCAAAGTATCTCGAGATACTTTGGGACTCTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-3746s1c1
Sequence:CCGGGCAATCTGGAACGGGACTATTCTCGAGAATAGTCCCGTTCCAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014682.2-3684s21c1
Sequence:CCGGCATCTATGGAGAGCAACTTAACTCGAGTTAAGTTGCTCTCCATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014682.2-2497s21c1
Sequence:CCGGCTCTTATAGCTACGGTCAATGCTCGAGCATTGACCGTAGCTATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014682
ST18 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014682.1-4498s1c1
Sequence:CCGGGCTCAGAATTTGTTAGCAATACTCGAGTATTGCTAACAAATTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-2644s1c1
Sequence:CCGGGCAGCATTCTATCAGGCTCTTCTCGAGAAGAGCCTGATAGAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-2494s1c1
Sequence:CCGGGCCGAAATAGAAGTGGATGAACTCGAGTTCATCCACTTCTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-1327s1c1
Sequence:CCGGCCACCTAGAGTCCCAAAGTATCTCGAGATACTTTGGGACTCTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014682.1-3746s1c1
Sequence:CCGGGCAATCTGGAACGGGACTATTCTCGAGAATAGTCCCGTTCCAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014682.2-3684s21c1
Sequence:CCGGCATCTATGGAGAGCAACTTAACTCGAGTTAAGTTGCTCTCCATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014682.2-2497s21c1
Sequence:CCGGCTCTTATAGCTACGGTCAATGCTCGAGCATTGACCGTAGCTATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173868
ST18 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-1657s1c1
Sequence:CCGGCGCAACACTCACAGAAGTCTTCTCGAGAAGACTTCTGTGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-836s1c1
Sequence:CCGGGCAGCAGTATCCAGTCTTTAACTCGAGTTAAAGACTGGATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-2813s1c1
Sequence:CCGGCTGAACTTAGATGCCCTGTAACTCGAGTTACAGGGCATCTAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-3384s1c1
Sequence:CCGGGCCTATCAATGAGCAGAATTTCTCGAGAAATTCTGCTCATTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-2242s1c1
Sequence:CCGGCGAATCCACGACAAGTCTATACTCGAGTATAGACTTGTCGTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1348s21c1
Sequence:CCGGTATAAGGAGCTGGACCGATTTCTCGAGAAATCGGTCCAGCTCCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1917s21c1
Sequence:CCGGGAAACGTCCTCTCCTACAAACCTCGAGGTTTGTAGGAGAGGACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1767s21c1
Sequence:CCGGGCAGGCACACAGGGTGAATTTCTCGAGAAATTCACCCTGTGTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-3184s21c1
Sequence:CCGGCTGAATGAATCCAACCTTAAACTCGAGTTTAAGGTTGGATTCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173868
ST18 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-1657s1c1
Sequence:CCGGCGCAACACTCACAGAAGTCTTCTCGAGAAGACTTCTGTGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-836s1c1
Sequence:CCGGGCAGCAGTATCCAGTCTTTAACTCGAGTTAAAGACTGGATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-2813s1c1
Sequence:CCGGCTGAACTTAGATGCCCTGTAACTCGAGTTACAGGGCATCTAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-3384s1c1
Sequence:CCGGGCCTATCAATGAGCAGAATTTCTCGAGAAATTCTGCTCATTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-2242s1c1
Sequence:CCGGCGAATCCACGACAAGTCTATACTCGAGTATAGACTTGTCGTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1348s21c1
Sequence:CCGGTATAAGGAGCTGGACCGATTTCTCGAGAAATCGGTCCAGCTCCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1917s21c1
Sequence:CCGGGAAACGTCCTCTCCTACAAACCTCGAGGTTTGTAGGAGAGGACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1767s21c1
Sequence:CCGGGCAGGCACACAGGGTGAATTTCTCGAGAAATTCACCCTGTGTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-3184s21c1
Sequence:CCGGCTGAATGAATCCAACCTTAAACTCGAGTTTAAGGTTGGATTCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173868
ST18 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-1657s1c1
Sequence:CCGGCGCAACACTCACAGAAGTCTTCTCGAGAAGACTTCTGTGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-836s1c1
Sequence:CCGGGCAGCAGTATCCAGTCTTTAACTCGAGTTAAAGACTGGATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-2813s1c1
Sequence:CCGGCTGAACTTAGATGCCCTGTAACTCGAGTTACAGGGCATCTAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-3384s1c1
Sequence:CCGGGCCTATCAATGAGCAGAATTTCTCGAGAAATTCTGCTCATTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173868.1-2242s1c1
Sequence:CCGGCGAATCCACGACAAGTCTATACTCGAGTATAGACTTGTCGTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1348s21c1
Sequence:CCGGTATAAGGAGCTGGACCGATTTCTCGAGAAATCGGTCCAGCTCCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1917s21c1
Sequence:CCGGGAAACGTCCTCTCCTACAAACCTCGAGGTTTGTAGGAGAGGACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-1767s21c1
Sequence:CCGGGCAGGCACACAGGGTGAATTTCTCGAGAAATTCACCCTGTGTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173868.1-3184s21c1
Sequence:CCGGCTGAATGAATCCAACCTTAAACTCGAGTTTAAGGTTGGATTCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks