EMAIL THIS PAGE TO A FRIEND

ST20

suppressor of tumorigenicity 20

Synonyms: HCCS-1
Species: Human ST20(400410)
UniProtKB ID: Q9HBF5
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100879 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100879 Rosetta Predictions human pricing
NM_001100880 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322467 predicted 793
2 SASI_Hs02_00322468 predicted 943
3 SASI_Hs02_00322469 predicted 938
4 SASI_Hs02_00322470 predicted 965
5 SASI_Hs02_00322471 predicted 942
6 SASI_Hs02_00322472 predicted 733
7 SASI_Hs02_00322473 predicted 800
8 SASI_Hs02_00322474 predicted 964
9 SASI_Hs02_00322475 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322476 predicted 407
2 SASI_Hs02_00322477 predicted 560
3 SASI_Hs02_00322478 predicted 560
4 SASI_Hs02_00322479 predicted 583
5 SASI_Hs02_00322480 predicted 559
6 SASI_Hs02_00322481 predicted 352
7 SASI_Hs02_00322482 predicted 420
8 SASI_Hs02_00322483 predicted 578
9 SASI_Hs02_00322484 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100879
VALIDATED
ST20 MISSION shRNA Bacterial Glycerol Stock
suppressor of tumorigenicity 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-822s21c1
Sequence:CCGGGCAATACTGTTGACCAGAAAGCTCGAGCTTTCTGGTCAACAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100879.1-853s21c1
Sequence:CCGGATTGTGAAACCGGCCTAATTTCTCGAGAAATTAGGCCGGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100879.1-709s21c1
Sequence:CCGGCTGTCTCCCAGGTTCAGGAAACTCGAGTTTCCTGAACCTGGGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-739s21c1
Sequence:CCGGTAAAGAAGCTTGAGCCTAAATCTCGAGATTTAGGCTCAAGCTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-793s21c1
Sequence:CCGGAGATCTGTGAAATGCTCTTCTCTCGAGAGAAGAGCATTTCACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100879
VALIDATED
ST20 MISSION shRNA shRNA Plasmid DNA
suppressor of tumorigenicity 20
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-822s21c1
Sequence:CCGGGCAATACTGTTGACCAGAAAGCTCGAGCTTTCTGGTCAACAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100879.1-853s21c1
Sequence:CCGGATTGTGAAACCGGCCTAATTTCTCGAGAAATTAGGCCGGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100879.1-709s21c1
Sequence:CCGGCTGTCTCCCAGGTTCAGGAAACTCGAGTTTCCTGAACCTGGGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-739s21c1
Sequence:CCGGTAAAGAAGCTTGAGCCTAAATCTCGAGATTTAGGCTCAAGCTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-793s21c1
Sequence:CCGGAGATCTGTGAAATGCTCTTCTCTCGAGAGAAGAGCATTTCACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100879
VALIDATED
ST20 MISSION shRNA Lentiviral Transduction Particles
suppressor of tumorigenicity 20
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-822s21c1
Sequence:CCGGGCAATACTGTTGACCAGAAAGCTCGAGCTTTCTGGTCAACAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100879.1-853s21c1
Sequence:CCGGATTGTGAAACCGGCCTAATTTCTCGAGAAATTAGGCCGGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100879.1-709s21c1
Sequence:CCGGCTGTCTCCCAGGTTCAGGAAACTCGAGTTTCCTGAACCTGGGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-739s21c1
Sequence:CCGGTAAAGAAGCTTGAGCCTAAATCTCGAGATTTAGGCTCAAGCTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100879.1-793s21c1
Sequence:CCGGAGATCTGTGAAATGCTCTTCTCTCGAGAGAAGAGCATTTCACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks