EMAIL THIS PAGE TO A FRIEND

ST3GAL1

ST3 beta-galactoside alpha-2,3-sialyltransferase 1

Synonyms: Gal-NAc6S SIAT4A SIATFL ST3GalA ST3GalA.1 ST3GalIA ST3GalIA,1 ST3O
UniProtKB ID: Q11201, O60677, Q9UN51
Gene ID:
Human(6482) Summary: The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
Mouse(20442) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Rat(362924) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Zebrafish(553279) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Horse(100069007) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
domestic cat(101089330) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
dog(482050) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
chicken(396140) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Domestic Rabbit(100339631) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
naked mole-rat(101720225) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
domestic guinea pig(100720961) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
cow(282351) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
sheep(101122606) ST3 beta-galactoside alpha-2,3-sialyltransferase 1
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003033 Rosetta Predictions human pricing
NM_173344 Rosetta Predictions human pricing
NM_001013219 Rosetta Predictions rat pricing
NM_009177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210826 predicted 1500
2 SASI_Hs01_00210827 predicted 2298
3 SASI_Hs01_00210828 predicted 2187
4 SASI_Hs01_00210829 predicted 1464
5 SASI_Hs01_00210830 predicted 2297
6 SASI_Hs01_00210831 predicted 2083
7 SASI_Hs01_00210832 predicted 1691
8 SASI_Hs02_00334936 predicted 1800
9 SASI_Hs02_00334937 predicted 2232
10 SASI_Hs02_00334938 predicted 1617
11 SASI_Hs01_00210823 predicted 2356
12 SASI_Hs01_00210824 predicted 1710
13 SASI_Hs01_00210825 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101179 predicted 1297
2 SASI_Hs01_00101180 predicted 2093
3 SASI_Hs01_00101181 predicted 1981
4 SASI_Hs01_00101182 predicted 1263
5 SASI_Hs01_00101183 predicted 2095
6 SASI_Hs01_00101184 predicted 1885
7 SASI_Hs01_00101185 predicted 1485
8 SASI_Hs02_00368179 predicted 1597
9 SASI_Hs02_00368180 predicted 2028
10 SASI_Hs02_00368181 predicted 1411
11 SASI_Hs01_00101176 predicted 2161
12 SASI_Hs01_00101177 predicted 1506
13 SASI_Hs01_00101178 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039072 predicted 194
2 SASI_Rn01_00039073 predicted 587
3 SASI_Rn01_00039075 predicted 518
4 SASI_Rn01_00039076 predicted 470
5 SASI_Rn01_00039077 predicted 431
6 SASI_Rn01_00039079 predicted 790
7 SASI_Rn01_00039080 predicted 215
8 SASI_Rn01_00039081 predicted 458
9 SASI_Rn02_00201021 predicted 324
10 SASI_Rn02_00201022 predicted 631
11 SASI_Rn01_00039074 predicted 494
12 SASI_Rn01_00039078 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089591 predicted 2018
2 SASI_Mm01_00089592 predicted 1816
3 SASI_Mm01_00089593 predicted 1355
4 SASI_Mm01_00089594 predicted 1947
5 SASI_Mm01_00089595 predicted 2003
6 SASI_Mm01_00089596 predicted 1994
7 SASI_Mm01_00089597 predicted 1110
8 SASI_Mm01_00089598 predicted 2025
9 SASI_Mm01_00089599 predicted 1450
10 SASI_Mm01_00089600 predicted 2004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003033
VALIDATED
ST3GAL1 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1326s21c1
Sequence:CCGGGCGGGAGAAGAAGCCCAATAACTCGAGTTATTGGGCTTCTTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1487s21c1
Sequence:CCGGAGATAGACAGTCACGACTTTGCTCGAGCAAAGTCGTGACTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1960s21c1
Sequence:CCGGGATGCAGACTTTGAGTCTAACCTCGAGGTTAGACTCAAAGTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003033.2-2417s21c1
Sequence:CCGGAGAGACTTGAGTGGCGATTACCTCGAGGTAATCGCCACTCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003033.2-1990s21c1
Sequence:CCGGACCTTGGCCTCCATCAATAAACTCGAGTTTATTGATGGAGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1759s1c1
Sequence:CCGGGCCTTCATCAAGTATGTCTTTCTCGAGAAAGACATACTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003033.2-1326s1c1
Sequence:CCGGGCGGGAGAAGAAGCCCAATAACTCGAGTTATTGGGCTTCTTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1086s1c1
Sequence:CCGGCCTGAACTACTCCCACACCATCTCGAGATGGTGTGGGAGTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003033.2-1602s1c1
Sequence:CCGGGCTGGGAGATAATGTCAGCATCTCGAGATGCTGACATTATCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1711s1c1
Sequence:CCGGCCTGCAAAGATCAGAGTGAAACTCGAGTTTCACTCTGATCTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003033
VALIDATED
ST3GAL1 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1326s21c1
Sequence:CCGGGCGGGAGAAGAAGCCCAATAACTCGAGTTATTGGGCTTCTTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1487s21c1
Sequence:CCGGAGATAGACAGTCACGACTTTGCTCGAGCAAAGTCGTGACTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1960s21c1
Sequence:CCGGGATGCAGACTTTGAGTCTAACCTCGAGGTTAGACTCAAAGTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003033.2-2417s21c1
Sequence:CCGGAGAGACTTGAGTGGCGATTACCTCGAGGTAATCGCCACTCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003033.2-1990s21c1
Sequence:CCGGACCTTGGCCTCCATCAATAAACTCGAGTTTATTGATGGAGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1759s1c1
Sequence:CCGGGCCTTCATCAAGTATGTCTTTCTCGAGAAAGACATACTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003033.2-1326s1c1
Sequence:CCGGGCGGGAGAAGAAGCCCAATAACTCGAGTTATTGGGCTTCTTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1086s1c1
Sequence:CCGGCCTGAACTACTCCCACACCATCTCGAGATGGTGTGGGAGTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003033.2-1602s1c1
Sequence:CCGGGCTGGGAGATAATGTCAGCATCTCGAGATGCTGACATTATCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1711s1c1
Sequence:CCGGCCTGCAAAGATCAGAGTGAAACTCGAGTTTCACTCTGATCTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003033
VALIDATED
ST3GAL1 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1326s21c1
Sequence:CCGGGCGGGAGAAGAAGCCCAATAACTCGAGTTATTGGGCTTCTTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1487s21c1
Sequence:CCGGAGATAGACAGTCACGACTTTGCTCGAGCAAAGTCGTGACTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003033.2-1960s21c1
Sequence:CCGGGATGCAGACTTTGAGTCTAACCTCGAGGTTAGACTCAAAGTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003033.2-2417s21c1
Sequence:CCGGAGAGACTTGAGTGGCGATTACCTCGAGGTAATCGCCACTCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003033.2-1990s21c1
Sequence:CCGGACCTTGGCCTCCATCAATAAACTCGAGTTTATTGATGGAGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1759s1c1
Sequence:CCGGGCCTTCATCAAGTATGTCTTTCTCGAGAAAGACATACTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003033.2-1326s1c1
Sequence:CCGGGCGGGAGAAGAAGCCCAATAACTCGAGTTATTGGGCTTCTTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1086s1c1
Sequence:CCGGCCTGAACTACTCCCACACCATCTCGAGATGGTGTGGGAGTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003033.2-1602s1c1
Sequence:CCGGGCTGGGAGATAATGTCAGCATCTCGAGATGCTGACATTATCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003033.2-1711s1c1
Sequence:CCGGCCTGCAAAGATCAGAGTGAAACTCGAGTTTCACTCTGATCTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009177
VALIDATED
ST3GAL1 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1817s1c1
Sequence:CCGGCGATGGTGACTTCGAGTACAACTCGAGTTGTACTCGAAGTCACCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1747s1c1
Sequence:CCGGGCAAAGGAAATTGGCACCATTCTCGAGAATGGTGCCAATTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1066s1c1
Sequence:CCGGGCCAGGACAAGGTATCATATTCTCGAGAATATGATACCTTGTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1212s1c1
Sequence:CCGGGACACCGTCAAGGAACTGTTTCTCGAGAAACAGTTCCTTGACGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009177.2-1094s1c1
Sequence:CCGGCCAGCGCTTCAACAAGACTATCTCGAGATAGTCTTGTTGAAGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009177
VALIDATED
ST3GAL1 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1817s1c1
Sequence:CCGGCGATGGTGACTTCGAGTACAACTCGAGTTGTACTCGAAGTCACCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1747s1c1
Sequence:CCGGGCAAAGGAAATTGGCACCATTCTCGAGAATGGTGCCAATTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1066s1c1
Sequence:CCGGGCCAGGACAAGGTATCATATTCTCGAGAATATGATACCTTGTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1212s1c1
Sequence:CCGGGACACCGTCAAGGAACTGTTTCTCGAGAAACAGTTCCTTGACGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009177.2-1094s1c1
Sequence:CCGGCCAGCGCTTCAACAAGACTATCTCGAGATAGTCTTGTTGAAGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009177
VALIDATED
ST3GAL1 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1817s1c1
Sequence:CCGGCGATGGTGACTTCGAGTACAACTCGAGTTGTACTCGAAGTCACCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1747s1c1
Sequence:CCGGGCAAAGGAAATTGGCACCATTCTCGAGAATGGTGCCAATTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1066s1c1
Sequence:CCGGGCCAGGACAAGGTATCATATTCTCGAGAATATGATACCTTGTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009177.2-1212s1c1
Sequence:CCGGGACACCGTCAAGGAACTGTTTCTCGAGAAACAGTTCCTTGACGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009177.2-1094s1c1
Sequence:CCGGCCAGCGCTTCAACAAGACTATCTCGAGATAGTCTTGTTGAAGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks