EMAIL THIS PAGE TO A FRIEND

ST3GAL2

ST3 beta-galactoside alpha-2,3-sialyltransferase 2

Synonyms: Gal-NAc6S SIAT4B ST3GALII ST3GalA.2
UniProtKB ID: Q16842, O00654
Gene ID:
Human(6483) Summary: The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4A. [provided by RefSeq, Jul 2008]
Mouse(20444) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Rat(64442) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Zebrafish(445562) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Horse(100054889) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
domestic cat(101087029) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
dog(489714) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
chicken(395139) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
cow(444879) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
sheep(101114207) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
domestic guinea pig(100721162) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
naked mole-rat(101721682) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Domestic Rabbit(100339474) ST3 beta-galactoside alpha-2,3-sialyltransferase 2
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006927 Rosetta Predictions human pricing
NM_031695 Rosetta Predictions rat pricing
NM_009179 Rosetta Predictions mouse pricing
NM_178048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079894 predicted 2007
2 SASI_Hs01_00079895 predicted 1535
3 SASI_Hs01_00079896 predicted 2125
4 SASI_Hs02_00342622 predicted 2259
5 SASI_Hs01_00079899 predicted 1917
6 SASI_Hs01_00079900 predicted 1395
7 SASI_Hs01_00079901 predicted 1456
8 SASI_Hs01_00079902 predicted 1399
9 SASI_Hs02_00342623 predicted 2383
10 SASI_Hs02_00342624 predicted 1396
11 SASI_Hs01_00079897 predicted 1878
12 SASI_Hs01_00079898 predicted 1779
13 SASI_Hs01_00079903 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036206 predicted 769
2 SASI_Rn01_00036207 predicted 758
3 SASI_Rn01_00036208 predicted 455
4 SASI_Rn01_00036209 predicted 976
5 SASI_Rn01_00036210 predicted 1053
6 SASI_Rn01_00036211 predicted 321
7 SASI_Rn01_00036212 predicted 731
8 SASI_Rn01_00036213 predicted 1089
9 SASI_Rn01_00036214 predicted 687
10 SASI_Rn02_00265049 predicted 1575
11 SASI_Rn01_00036205 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315539 predicted 2453
2 SASI_Mm01_00163736 predicted 1857
3 SASI_Mm02_00315540 predicted 1454
4 SASI_Mm02_00315541 predicted 2060
5 SASI_Mm02_00315542 predicted 1935
6 SASI_Mm02_00315543 predicted 1360
7 SASI_Mm02_00315544 predicted 2699
8 SASI_Mm02_00315545 predicted 1762
9 SASI_Mm02_00315546 predicted 1775
10 SASI_Mm02_00315547 predicted 1891
11 SASI_Mm01_00163735 predicted 642
12 SASI_Mm01_00163737 predicted 684
13 SASI_Mm01_00163738 predicted 761
14 SASI_Mm01_00163739 predicted 805
15 SASI_Mm01_00163740 predicted 647
16 SASI_Mm01_00163741 predicted 723
17 SASI_Mm01_00163742 predicted 762
18 SASI_Mm01_00163743 predicted 649
19 SASI_Mm01_00163744 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034727 predicted 1677
2 SASI_Mm01_00034728 predicted 1799
3 SASI_Mm01_00034729 predicted 1719
4 SASI_Mm01_00034730 predicted 1799
5 SASI_Mm01_00034731 predicted 1838
6 SASI_Mm01_00034732 predicted 1679
7 SASI_Mm01_00034733 predicted 1761
8 SASI_Mm01_00034734 predicted 1794
9 SASI_Mm01_00034735 predicted 1684
10 SASI_Mm01_00034736 predicted 1637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006927
VALIDATED
ST3GAL2 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1403s1c1
Sequence:CCGGGCCACTTTGACGGTAACATTTCTCGAGAAATGTTACCGTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1659s1c1
Sequence:CCGGGCACAACTTCATCATGAGGATCTCGAGATCCTCATGATGAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1874s1c1
Sequence:CCGGAGTCCTTCCTTCGAGTGGATACTCGAGTATCCACTCGAAGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1464s1c1
Sequence:CCGGCGTCCAGAGGTGGTGGATGATCTCGAGATCATCCACCACCTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-2133s1c1
Sequence:CCGGCGAGGCCCACATCATCGACATCTCGAGATGTCGATGATGTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1917s21c1
Sequence:CCGGCCCAGCCTTCTTCAAGTATATCTCGAGATATACTTGAAGAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-4001s21c1
Sequence:CCGGGGCGGATTACTTAATACTTAACTCGAGTTAAGTATTAAGTAATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1526s21c1
Sequence:CCGGTGGAGAAGCTGTTCCAGATAGCTCGAGCTATCTGGAACAGCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1876s21c1
Sequence:CCGGTCCTTCCTTCGAGTGGATAAACTCGAGTTTATCCACTCGAAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1404s21c1
Sequence:CCGGCCACTTTGACGGTAACATTTCCTCGAGGAAATGTTACCGTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006927
VALIDATED
ST3GAL2 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1403s1c1
Sequence:CCGGGCCACTTTGACGGTAACATTTCTCGAGAAATGTTACCGTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1659s1c1
Sequence:CCGGGCACAACTTCATCATGAGGATCTCGAGATCCTCATGATGAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1874s1c1
Sequence:CCGGAGTCCTTCCTTCGAGTGGATACTCGAGTATCCACTCGAAGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1464s1c1
Sequence:CCGGCGTCCAGAGGTGGTGGATGATCTCGAGATCATCCACCACCTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-2133s1c1
Sequence:CCGGCGAGGCCCACATCATCGACATCTCGAGATGTCGATGATGTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1917s21c1
Sequence:CCGGCCCAGCCTTCTTCAAGTATATCTCGAGATATACTTGAAGAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-4001s21c1
Sequence:CCGGGGCGGATTACTTAATACTTAACTCGAGTTAAGTATTAAGTAATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1526s21c1
Sequence:CCGGTGGAGAAGCTGTTCCAGATAGCTCGAGCTATCTGGAACAGCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1876s21c1
Sequence:CCGGTCCTTCCTTCGAGTGGATAAACTCGAGTTTATCCACTCGAAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1404s21c1
Sequence:CCGGCCACTTTGACGGTAACATTTCCTCGAGGAAATGTTACCGTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006927
VALIDATED
ST3GAL2 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1403s1c1
Sequence:CCGGGCCACTTTGACGGTAACATTTCTCGAGAAATGTTACCGTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1659s1c1
Sequence:CCGGGCACAACTTCATCATGAGGATCTCGAGATCCTCATGATGAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1874s1c1
Sequence:CCGGAGTCCTTCCTTCGAGTGGATACTCGAGTATCCACTCGAAGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-1464s1c1
Sequence:CCGGCGTCCAGAGGTGGTGGATGATCTCGAGATCATCCACCACCTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006927.2-2133s1c1
Sequence:CCGGCGAGGCCCACATCATCGACATCTCGAGATGTCGATGATGTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1917s21c1
Sequence:CCGGCCCAGCCTTCTTCAAGTATATCTCGAGATATACTTGAAGAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-4001s21c1
Sequence:CCGGGGCGGATTACTTAATACTTAACTCGAGTTAAGTATTAAGTAATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1526s21c1
Sequence:CCGGTGGAGAAGCTGTTCCAGATAGCTCGAGCTATCTGGAACAGCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1876s21c1
Sequence:CCGGTCCTTCCTTCGAGTGGATAAACTCGAGTTTATCCACTCGAAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006927.3-1404s21c1
Sequence:CCGGCCACTTTGACGGTAACATTTCCTCGAGGAAATGTTACCGTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009179
VALIDATED
ST3GAL2 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-680s1c1
Sequence:CCGGCCGAACAACTCACCATTTCATCTCGAGATGAAATGGTGAGTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-348s1c1
Sequence:CCGGGAATGGTTTGACAGCCACTTTCTCGAGAAAGTGGCTGTCAAACCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-863s1c1
Sequence:CCGGCCAGATTTACAACCCAGCCTTCTCGAGAAGGCTGGGTTGTAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-948s1c1
Sequence:CCGGGTGCTCTTCTTTGCACTACATCTCGAGATGTAGTGCAAAGAAGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-386s1c1
Sequence:CCGGCGTCTGGACCAGAGATAACATCTCGAGATGTTATCTCTGGTCCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1957s21c1
Sequence:CCGGCCAGATTTACAACCCAGCCTTCTCGAGAAGGCTGGGTTGTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1774s21c1
Sequence:CCGGCCGAACAACTCACCATTTCATCTCGAGATGAAATGGTGAGTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-2042s21c1
Sequence:CCGGGTGCTCTTCTTTGCACTACATCTCGAGATGTAGTGCAAAGAAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1480s21c1
Sequence:CCGGCGTCTGGACCAGAGATAACATCTCGAGATGTTATCTCTGGTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009179
VALIDATED
ST3GAL2 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-680s1c1
Sequence:CCGGCCGAACAACTCACCATTTCATCTCGAGATGAAATGGTGAGTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-348s1c1
Sequence:CCGGGAATGGTTTGACAGCCACTTTCTCGAGAAAGTGGCTGTCAAACCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-863s1c1
Sequence:CCGGCCAGATTTACAACCCAGCCTTCTCGAGAAGGCTGGGTTGTAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-948s1c1
Sequence:CCGGGTGCTCTTCTTTGCACTACATCTCGAGATGTAGTGCAAAGAAGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-386s1c1
Sequence:CCGGCGTCTGGACCAGAGATAACATCTCGAGATGTTATCTCTGGTCCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1957s21c1
Sequence:CCGGCCAGATTTACAACCCAGCCTTCTCGAGAAGGCTGGGTTGTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1774s21c1
Sequence:CCGGCCGAACAACTCACCATTTCATCTCGAGATGAAATGGTGAGTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-2042s21c1
Sequence:CCGGGTGCTCTTCTTTGCACTACATCTCGAGATGTAGTGCAAAGAAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1480s21c1
Sequence:CCGGCGTCTGGACCAGAGATAACATCTCGAGATGTTATCTCTGGTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009179
VALIDATED
ST3GAL2 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-680s1c1
Sequence:CCGGCCGAACAACTCACCATTTCATCTCGAGATGAAATGGTGAGTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-348s1c1
Sequence:CCGGGAATGGTTTGACAGCCACTTTCTCGAGAAAGTGGCTGTCAAACCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-863s1c1
Sequence:CCGGCCAGATTTACAACCCAGCCTTCTCGAGAAGGCTGGGTTGTAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-948s1c1
Sequence:CCGGGTGCTCTTCTTTGCACTACATCTCGAGATGTAGTGCAAAGAAGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009179.1-386s1c1
Sequence:CCGGCGTCTGGACCAGAGATAACATCTCGAGATGTTATCTCTGGTCCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1957s21c1
Sequence:CCGGCCAGATTTACAACCCAGCCTTCTCGAGAAGGCTGGGTTGTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1774s21c1
Sequence:CCGGCCGAACAACTCACCATTTCATCTCGAGATGAAATGGTGAGTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-2042s21c1
Sequence:CCGGGTGCTCTTCTTTGCACTACATCTCGAGATGTAGTGCAAAGAAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009179.3-1480s21c1
Sequence:CCGGCGTCTGGACCAGAGATAACATCTCGAGATGTTATCTCTGGTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks