EMAIL THIS PAGE TO A FRIEND

ST3GAL3

ST3 beta-galactoside alpha-2,3-sialyltransferase 3

Synonyms: EIEE15 MRT12 SIAT6 ST3GALII ST3GalIII ST3N
Gene ID:
Human(6487) Summary: The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with autosomal recessive nonsymdromic mental retardation-12 (MRT12). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(20441) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Rat(64445) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
chicken(424572) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
dog(610736) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
domestic cat(101081911) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Domestic Rabbit(100353106) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
naked mole-rat(101716398) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
domestic guinea pig(100724423) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
cow(444859) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
sheep(101112269) ST3 beta-galactoside alpha-2,3-sialyltransferase 3
322 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006279 Rosetta Predictions human pricing
NM_174963 Rosetta Predictions human pricing
NM_174964 Rosetta Predictions human pricing
NM_174965 Rosetta Predictions human pricing
NM_174966 Rosetta Predictions human pricing
NM_174967 Rosetta Predictions human pricing
NM_174968 Rosetta Predictions human pricing
NM_174969 Rosetta Predictions human pricing
NM_174970 Rosetta Predictions human pricing
NM_174971 Rosetta Predictions human pricing
NM_031697 Rosetta Predictions rat pricing
NM_009176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183805 predicted 1546
2 SASI_Hs02_00341255 predicted 1570
3 SASI_Hs01_00183807 predicted 1591
4 SASI_Hs01_00183808 predicted 1607
5 SASI_Hs01_00183809 predicted 1485
6 SASI_Hs01_00183811 predicted 1734
7 SASI_Hs01_00183806 predicted 1604
8 SASI_Hs02_00341256 predicted 1645
9 SASI_Hs01_00183813 predicted 1127
10 SASI_Hs01_00183814 predicted 195
11 SASI_Hs01_00183810 predicted 1601
12 SASI_Hs01_00183812 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062329 predicted 1750
2 SASI_Hs02_00368897 predicted 1774
3 SASI_Hs01_00062331 predicted 1789
4 SASI_Hs01_00062332 predicted 1815
5 SASI_Hs01_00062333 predicted 1684
6 SASI_Hs01_00062335 predicted 1945
7 SASI_Hs01_00062330 predicted 1804
8 SASI_Hs02_00368898 predicted 1852
9 SASI_Hs01_00062337 predicted 1340
10 SASI_Hs01_00062338 predicted 198
11 SASI_Hs01_00062334 predicted 1808
12 SASI_Hs01_00062336 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171599 predicted 1592
2 SASI_Hs02_00368899 predicted 1612
3 SASI_Hs01_00171601 predicted 1634
4 SASI_Hs01_00171602 predicted 1654
5 SASI_Hs01_00171603 predicted 1528
6 SASI_Hs01_00171605 predicted 1775
7 SASI_Hs01_00171600 predicted 1647
8 SASI_Hs02_00368900 predicted 1695
9 SASI_Hs01_00171607 predicted 1180
10 SASI_Hs01_00171608 predicted 197
11 SASI_Hs01_00171604 predicted 1654
12 SASI_Hs01_00171606 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157631 predicted 953
2 SASI_Hs02_00368901 predicted 973
3 SASI_Hs01_00157633 predicted 990
4 SASI_Hs01_00157634 predicted 1008
5 SASI_Hs01_00157635 predicted 882
6 SASI_Hs01_00157637 predicted 1136
7 SASI_Hs01_00157632 predicted 1003
8 SASI_Hs02_00368902 predicted 1050
9 SASI_Hs01_00157639 predicted 439
10 SASI_Hs01_00157640 predicted 199
11 SASI_Hs01_00157636 predicted 1005
12 SASI_Hs01_00157638 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207603 predicted 1256
2 SASI_Hs02_00368903 predicted 1277
3 SASI_Hs01_00207605 predicted 1290
4 SASI_Hs01_00207606 predicted 1312
5 SASI_Hs01_00207607 predicted 1187
6 SASI_Hs01_00207609 predicted 1436
7 SASI_Hs01_00207604 predicted 1301
8 SASI_Hs02_00368904 predicted 1351
9 SASI_Hs01_00207611 predicted 874
10 SASI_Hs01_00207612 predicted 190
11 SASI_Hs01_00207608 predicted 1307
12 SASI_Hs01_00207610 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037609 predicted 908
2 SASI_Hs02_00368905 predicted 933
3 SASI_Hs01_00037611 predicted 947
4 SASI_Hs01_00037612 predicted 964
5 SASI_Hs01_00037613 predicted 843
6 SASI_Hs01_00037615 predicted 1091
7 SASI_Hs01_00037610 predicted 957
8 SASI_Hs02_00368906 predicted 1010
9 SASI_Hs01_00037617 predicted 401
10 SASI_Hs01_00037618 predicted 199
11 SASI_Hs01_00037614 predicted 970
12 SASI_Hs01_00037616 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152883 predicted 1709
2 SASI_Hs02_00368907 predicted 1738
3 SASI_Hs01_00152885 predicted 1752
4 SASI_Hs01_00152886 predicted 1770
5 SASI_Hs01_00152887 predicted 1642
6 SASI_Hs01_00152889 predicted 1895
7 SASI_Hs01_00152884 predicted 1764
8 SASI_Hs02_00368908 predicted 1813
9 SASI_Hs01_00152891 predicted 1289
10 SASI_Hs01_00152892 predicted 191
11 SASI_Hs01_00152888 predicted 1773
12 SASI_Hs01_00152890 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231832 predicted 1498
2 SASI_Hs02_00368909 predicted 1522
3 SASI_Hs01_00231834 predicted 1534
4 SASI_Hs01_00231835 predicted 1557
5 SASI_Hs01_00231836 predicted 1436
6 SASI_Hs01_00231838 predicted 1689
7 SASI_Hs01_00231833 predicted 1555
8 SASI_Hs02_00368910 predicted 1597
9 SASI_Hs01_00231840 predicted 825
10 SASI_Hs02_00368911 predicted 1085
11 SASI_Hs01_00231837 predicted 1560
12 SASI_Hs01_00231839 predicted 1436
13 SASI_Hs01_00231841 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064610 predicted 855
2 SASI_Hs02_00368912 predicted 880
3 SASI_Hs01_00064612 predicted 897
4 SASI_Hs01_00064613 predicted 919
5 SASI_Hs01_00064614 predicted 793
6 SASI_Hs01_00064616 predicted 1041
7 SASI_Hs01_00064611 predicted 906
8 SASI_Hs02_00368913 predicted 955
9 SASI_Hs01_00064618 predicted 349
10 SASI_Hs01_00064619 predicted 195
11 SASI_Hs01_00064615 predicted 914
12 SASI_Hs01_00064617 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046388 predicted 1660
2 SASI_Hs02_00368914 predicted 1684
3 SASI_Hs01_00046390 predicted 1699
4 SASI_Hs01_00046391 predicted 1721
5 SASI_Hs01_00046392 predicted 1592
6 SASI_Hs01_00046394 predicted 1845
7 SASI_Hs01_00046389 predicted 1718
8 SASI_Hs02_00368915 predicted 1756
9 SASI_Hs01_00046396 predicted 990
10 SASI_Hs02_00368916 predicted 1246
11 SASI_Hs01_00046393 predicted 1718
12 SASI_Hs01_00046395 predicted 1592
13 SASI_Hs01_00046397 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090294 predicted 408
2 SASI_Rn01_00090296 predicted 767
3 SASI_Rn02_00265052 predicted 786
4 SASI_Rn01_00090297 predicted 952
5 SASI_Rn01_00090298 predicted 618
6 SASI_Rn01_00090299 predicted 776
7 SASI_Rn01_00090300 predicted 432
8 SASI_Rn01_00090301 predicted 302
9 SASI_Rn01_00090302 predicted 222
10 SASI_Rn01_00090303 predicted 257
11 SASI_Rn01_00090295 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080705 predicted 1063
2 SASI_Mm01_00080706 predicted 1568
3 SASI_Mm01_00080708 predicted 531
4 SASI_Mm01_00080709 predicted 1060
5 SASI_Mm01_00080710 predicted 553
6 SASI_Mm01_00080711 predicted 1176
7 SASI_Mm01_00080713 predicted 928
8 SASI_Mm01_00080714 predicted 1628
9 SASI_Mm02_00315536 predicted 1180
10 SASI_Mm02_00315537 predicted 1605
11 SASI_Mm01_00080707 predicted 1227
12 SASI_Mm01_00080712 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009176
VALIDATED
ST3GAL3 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-751s21c1
Sequence:CCGGGCCACCAAGTACGCAAACTTTCTCGAGAAAGTTTGCGTACTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009176.3-715s21c1
Sequence:CCGGCTCCTGAAGCTGGACTCTAAACTCGAGTTTAGAGTCCAGCTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-1242s21c1
Sequence:CCGGGCTGAAGTACATCGTCTACAACTCGAGTTGTAGACGATGTACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009176.3-1168s21c1
Sequence:CCGGATGCAGCGACCTGAGCAATATCTCGAGATATTGCTCAGGTCGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-1954s21c1
Sequence:CCGGGTGTTTGGTGTATTATCATTTCTCGAGAAATGATAATACACCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-752s1c1
Sequence:CCGGGCCACCAAGTACGCAAACTTTCTCGAGAAAGTTTGCGTACTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-1058s1c1
Sequence:CCGGCGGATTGACGACTATGACATTCTCGAGAATGTCATAGTCGTCAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009176.2-1622s1c1
Sequence:CCGGGCACGTGTCATCACTGACTTACTCGAGTAAGTCAGTGATGACACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-1243s1c1
Sequence:CCGGGCTGAAGTACATCGTCTACAACTCGAGTTGTAGACGATGTACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009176.2-1004s1c1
Sequence:CCGGCGCTGCATCATTGTAGGCAATCTCGAGATTGCCTACAATGATGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009176
VALIDATED
ST3GAL3 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-751s21c1
Sequence:CCGGGCCACCAAGTACGCAAACTTTCTCGAGAAAGTTTGCGTACTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009176.3-715s21c1
Sequence:CCGGCTCCTGAAGCTGGACTCTAAACTCGAGTTTAGAGTCCAGCTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-1242s21c1
Sequence:CCGGGCTGAAGTACATCGTCTACAACTCGAGTTGTAGACGATGTACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009176.3-1168s21c1
Sequence:CCGGATGCAGCGACCTGAGCAATATCTCGAGATATTGCTCAGGTCGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-1954s21c1
Sequence:CCGGGTGTTTGGTGTATTATCATTTCTCGAGAAATGATAATACACCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-752s1c1
Sequence:CCGGGCCACCAAGTACGCAAACTTTCTCGAGAAAGTTTGCGTACTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-1058s1c1
Sequence:CCGGCGGATTGACGACTATGACATTCTCGAGAATGTCATAGTCGTCAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009176.2-1622s1c1
Sequence:CCGGGCACGTGTCATCACTGACTTACTCGAGTAAGTCAGTGATGACACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-1243s1c1
Sequence:CCGGGCTGAAGTACATCGTCTACAACTCGAGTTGTAGACGATGTACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009176.2-1004s1c1
Sequence:CCGGCGCTGCATCATTGTAGGCAATCTCGAGATTGCCTACAATGATGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009176
VALIDATED
ST3GAL3 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-751s21c1
Sequence:CCGGGCCACCAAGTACGCAAACTTTCTCGAGAAAGTTTGCGTACTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009176.3-715s21c1
Sequence:CCGGCTCCTGAAGCTGGACTCTAAACTCGAGTTTAGAGTCCAGCTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-1242s21c1
Sequence:CCGGGCTGAAGTACATCGTCTACAACTCGAGTTGTAGACGATGTACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009176.3-1168s21c1
Sequence:CCGGATGCAGCGACCTGAGCAATATCTCGAGATATTGCTCAGGTCGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009176.3-1954s21c1
Sequence:CCGGGTGTTTGGTGTATTATCATTTCTCGAGAAATGATAATACACCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-752s1c1
Sequence:CCGGGCCACCAAGTACGCAAACTTTCTCGAGAAAGTTTGCGTACTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-1058s1c1
Sequence:CCGGCGGATTGACGACTATGACATTCTCGAGAATGTCATAGTCGTCAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009176.2-1622s1c1
Sequence:CCGGGCACGTGTCATCACTGACTTACTCGAGTAAGTCAGTGATGACACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009176.2-1243s1c1
Sequence:CCGGGCTGAAGTACATCGTCTACAACTCGAGTTGTAGACGATGTACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009176.2-1004s1c1
Sequence:CCGGCGCTGCATCATTGTAGGCAATCTCGAGATTGCCTACAATGATGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006279
VALIDATED
ST3GAL3 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-517s21c1
Sequence:CCGGTTTCGCAAGTGGGCTAGAATCCTCGAGGATTCTAGCCCACTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-984s21c1
Sequence:CCGGTCGAATCCTCAACCCATATTTCTCGAGAAATATGGGTTGAGGATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-707s21c1
Sequence:CCGGGAATTGACGACTATGACATTGCTCGAGCAATGTCATAGTCGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-1612s21c1
Sequence:CCGGGTGTTTGGTGTATTATCATTTCTCGAGAAATGATAATACACCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-1272s21c1
Sequence:CCGGTCGCGTCATCACTGATCTAAGCTCGAGCTTAGATCAGTGATGACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-876s1c1
Sequence:CCGGGCAGGACTTTAAGTGGTTGAACTCGAGTTCAACCACTTAAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-1224s1c1
Sequence:CCGGGCACAATATCCAGCGAGAGAACTCGAGTTCTCTCGCTGGATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-1134s1c1
Sequence:CCGGCGCAGGATTTGGCTATGACATCTCGAGATGTCATAGCCAAATCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-363s1c1
Sequence:CCGGCCTCCTGAATCTGGACTCTAACTCGAGTTAGAGTCCAGATTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-589s1c1
Sequence:CCGGGCCATCTTGTCAGTCACCAAACTCGAGTTTGGTGACTGACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006279
VALIDATED
ST3GAL3 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-517s21c1
Sequence:CCGGTTTCGCAAGTGGGCTAGAATCCTCGAGGATTCTAGCCCACTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-984s21c1
Sequence:CCGGTCGAATCCTCAACCCATATTTCTCGAGAAATATGGGTTGAGGATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-707s21c1
Sequence:CCGGGAATTGACGACTATGACATTGCTCGAGCAATGTCATAGTCGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-1612s21c1
Sequence:CCGGGTGTTTGGTGTATTATCATTTCTCGAGAAATGATAATACACCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-1272s21c1
Sequence:CCGGTCGCGTCATCACTGATCTAAGCTCGAGCTTAGATCAGTGATGACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-876s1c1
Sequence:CCGGGCAGGACTTTAAGTGGTTGAACTCGAGTTCAACCACTTAAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-1224s1c1
Sequence:CCGGGCACAATATCCAGCGAGAGAACTCGAGTTCTCTCGCTGGATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-1134s1c1
Sequence:CCGGCGCAGGATTTGGCTATGACATCTCGAGATGTCATAGCCAAATCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-363s1c1
Sequence:CCGGCCTCCTGAATCTGGACTCTAACTCGAGTTAGAGTCCAGATTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-589s1c1
Sequence:CCGGGCCATCTTGTCAGTCACCAAACTCGAGTTTGGTGACTGACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006279
VALIDATED
ST3GAL3 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-517s21c1
Sequence:CCGGTTTCGCAAGTGGGCTAGAATCCTCGAGGATTCTAGCCCACTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-984s21c1
Sequence:CCGGTCGAATCCTCAACCCATATTTCTCGAGAAATATGGGTTGAGGATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-707s21c1
Sequence:CCGGGAATTGACGACTATGACATTGCTCGAGCAATGTCATAGTCGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-1612s21c1
Sequence:CCGGGTGTTTGGTGTATTATCATTTCTCGAGAAATGATAATACACCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006279.2-1272s21c1
Sequence:CCGGTCGCGTCATCACTGATCTAAGCTCGAGCTTAGATCAGTGATGACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-876s1c1
Sequence:CCGGGCAGGACTTTAAGTGGTTGAACTCGAGTTCAACCACTTAAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-1224s1c1
Sequence:CCGGGCACAATATCCAGCGAGAGAACTCGAGTTCTCTCGCTGGATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-1134s1c1
Sequence:CCGGCGCAGGATTTGGCTATGACATCTCGAGATGTCATAGCCAAATCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-363s1c1
Sequence:CCGGCCTCCTGAATCTGGACTCTAACTCGAGTTAGAGTCCAGATTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006279.2-589s1c1
Sequence:CCGGGCCATCTTGTCAGTCACCAAACTCGAGTTTGGTGACTGACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks