EMAIL THIS PAGE TO A FRIEND

ST3GAL4

ST3 beta-galactoside alpha-2,3-sialyltransferase 4

Synonyms: CGS23 NANTA3 SAT3 SIAT4 SIAT4C ST3GalIV STZ
UniProtKB ID: Q11206, A8K6B2, O60497, Q8N6A6, Q8NFG7, Q96QQ9
Gene ID:
Human(6484) Summary: This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(20443) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Rat(363040) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Zebrafish(504044) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
domestic cat(101089461) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
dog(607094) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
chicken(419718) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
cow(404163) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
sheep(100127212) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
domestic guinea pig(100729178) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
naked mole-rat(101716004) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Domestic Rabbit(100008715) ST3 beta-galactoside alpha-2,3-sialyltransferase 4
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108044 Anti-ST3GAL4 antibody produced in rabbit affinity isolated antibody canine, human, rat, rabbit, pig, horse, mouse, guinea pig, bovine
immunohistochemistry, western blot pricing
SAB2103338 Anti-ST3GAL4 antibody produced in rabbit affinity isolated antibody , pig, human, bovine, mouse, canine, rabbit, guinea pig, rabbit, rat, horse, sheep
western blot pricing
HPA049827 Anti-ST3GAL4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1402355 Monoclonal Anti-ST3GAL4 antibody produced in mouse clone 1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006278 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006278 Rosetta Predictions human pricing
NM_203337 Rosetta Predictions rat pricing
NM_009178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040898 predicted 694
2 SASI_Hs02_00341251 predicted 731
3 SASI_Hs01_00040901 predicted 969
4 SASI_Hs01_00040902 predicted 377
5 SASI_Hs02_00341252 predicted 813
6 SASI_Hs01_00040903 predicted 208
7 SASI_Hs01_00040904 predicted 705
8 SASI_Hs01_00040905 predicted 353
9 SASI_Hs02_00341253 predicted 211
10 SASI_Hs02_00341254 predicted 1032
11 SASI_Hs01_00040897 predicted 892
12 SASI_Hs01_00040899 predicted 1490
13 SASI_Hs01_00040900 predicted 900
14 SASI_Hs01_00040906 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095781 predicted 1118
2 SASI_Rn01_00095783 predicted 654
3 SASI_Rn01_00095784 predicted 446
4 SASI_Rn01_00095785 predicted 841
5 SASI_Rn01_00095786 predicted 674
6 SASI_Rn02_00270359 predicted 297
7 SASI_Rn01_00095787 predicted 1177
8 SASI_Rn01_00095788 predicted 1216
9 SASI_Rn01_00095789 predicted 633
10 SASI_Rn01_00095790 predicted 974
11 SASI_Rn01_00095782 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136883 predicted 1059
2 SASI_Mm02_00315538 predicted 998
3 SASI_Mm01_00136884 predicted 475
4 SASI_Mm01_00136885 predicted 969
5 SASI_Mm01_00136886 predicted 658
6 SASI_Mm01_00136887 predicted 397
7 SASI_Mm01_00136888 predicted 1116
8 SASI_Mm01_00136889 predicted 231
9 SASI_Mm01_00136891 predicted 906
10 SASI_Mm01_00136892 predicted 1049
11 SASI_Mm01_00136890 predicted 1164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009178
VALIDATED
ST3GAL4 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009178.2-764s1c1
Sequence:CCGGCCACTGGATTGAGACCATCTTCTCGAGAAGATGGTCTCAATCCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-1049s1c1
Sequence:CCGGCATCCACTACTATGAACAGATCTCGAGATCTGTTCATAGTAGTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-477s1c1
Sequence:CCGGGCCATCACTAGCTATTCTATACTCGAGTATAGAATAGCTAGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-258s1c1
Sequence:CCGGGATAGGTACATTGAGTTCTTTCTCGAGAAAGAACTCAATGTACCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-596s1c1
Sequence:CCGGCGACGTGGTCATCAGATTGAACTCGAGTTCAATCTGATGACCACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-258s21c1
Sequence:CCGGGATAGGTACATTGAGTTCTTTCTCGAGAAAGAACTCAATGTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-477s21c1
Sequence:CCGGGCCATCACTAGCTATTCTATACTCGAGTATAGAATAGCTAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-764s21c1
Sequence:CCGGCCACTGGATTGAGACCATCTTCTCGAGAAGATGGTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-596s21c1
Sequence:CCGGCGACGTGGTCATCAGATTGAACTCGAGTTCAATCTGATGACCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-1049s21c1
Sequence:CCGGCATCCACTACTATGAACAGATCTCGAGATCTGTTCATAGTAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009178
VALIDATED
ST3GAL4 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009178.2-764s1c1
Sequence:CCGGCCACTGGATTGAGACCATCTTCTCGAGAAGATGGTCTCAATCCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-1049s1c1
Sequence:CCGGCATCCACTACTATGAACAGATCTCGAGATCTGTTCATAGTAGTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-477s1c1
Sequence:CCGGGCCATCACTAGCTATTCTATACTCGAGTATAGAATAGCTAGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-258s1c1
Sequence:CCGGGATAGGTACATTGAGTTCTTTCTCGAGAAAGAACTCAATGTACCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-596s1c1
Sequence:CCGGCGACGTGGTCATCAGATTGAACTCGAGTTCAATCTGATGACCACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-258s21c1
Sequence:CCGGGATAGGTACATTGAGTTCTTTCTCGAGAAAGAACTCAATGTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-477s21c1
Sequence:CCGGGCCATCACTAGCTATTCTATACTCGAGTATAGAATAGCTAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-764s21c1
Sequence:CCGGCCACTGGATTGAGACCATCTTCTCGAGAAGATGGTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-596s21c1
Sequence:CCGGCGACGTGGTCATCAGATTGAACTCGAGTTCAATCTGATGACCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-1049s21c1
Sequence:CCGGCATCCACTACTATGAACAGATCTCGAGATCTGTTCATAGTAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009178
VALIDATED
ST3GAL4 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009178.2-764s1c1
Sequence:CCGGCCACTGGATTGAGACCATCTTCTCGAGAAGATGGTCTCAATCCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-1049s1c1
Sequence:CCGGCATCCACTACTATGAACAGATCTCGAGATCTGTTCATAGTAGTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-477s1c1
Sequence:CCGGGCCATCACTAGCTATTCTATACTCGAGTATAGAATAGCTAGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-258s1c1
Sequence:CCGGGATAGGTACATTGAGTTCTTTCTCGAGAAAGAACTCAATGTACCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009178.2-596s1c1
Sequence:CCGGCGACGTGGTCATCAGATTGAACTCGAGTTCAATCTGATGACCACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-258s21c1
Sequence:CCGGGATAGGTACATTGAGTTCTTTCTCGAGAAAGAACTCAATGTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-477s21c1
Sequence:CCGGGCCATCACTAGCTATTCTATACTCGAGTATAGAATAGCTAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-764s21c1
Sequence:CCGGCCACTGGATTGAGACCATCTTCTCGAGAAGATGGTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-596s21c1
Sequence:CCGGCGACGTGGTCATCAGATTGAACTCGAGTTCAATCTGATGACCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009178.3-1049s21c1
Sequence:CCGGCATCCACTACTATGAACAGATCTCGAGATCTGTTCATAGTAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006278
ST3GAL4 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006278.1-1415s1c1
Sequence:CCGGCCAGCACCAAGAGATTATTTACTCGAGTAAATAATCTCTTGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-714s1c1
Sequence:CCGGCCTGGTAGCTTTCAAGGCAATCTCGAGATTGCCTTGAAAGCTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-730s1c1
Sequence:CCGGGCAATGGACTTCCACTGGATTCTCGAGAATCCAGTGGAAGTCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-357s1c1
Sequence:CCGGCCTGCGGCTTGAGGATTATTTCTCGAGAAATAATCCTCAAGCCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-903s1c1
Sequence:CCGGGCCACGGAAGATTAAGCAGAACTCGAGTTCTGCTTAATCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-903s21c1
Sequence:CCGGGCCACGGAAGATTAAGCAGAACTCGAGTTCTGCTTAATCTTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-714s21c1
Sequence:CCGGCCTGGTAGCTTTCAAGGCAATCTCGAGATTGCCTTGAAAGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-730s21c1
Sequence:CCGGGCAATGGACTTCCACTGGATTCTCGAGAATCCAGTGGAAGTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-357s21c1
Sequence:CCGGCCTGCGGCTTGAGGATTATTTCTCGAGAAATAATCCTCAAGCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006278
ST3GAL4 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006278.1-1415s1c1
Sequence:CCGGCCAGCACCAAGAGATTATTTACTCGAGTAAATAATCTCTTGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-714s1c1
Sequence:CCGGCCTGGTAGCTTTCAAGGCAATCTCGAGATTGCCTTGAAAGCTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-730s1c1
Sequence:CCGGGCAATGGACTTCCACTGGATTCTCGAGAATCCAGTGGAAGTCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-357s1c1
Sequence:CCGGCCTGCGGCTTGAGGATTATTTCTCGAGAAATAATCCTCAAGCCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-903s1c1
Sequence:CCGGGCCACGGAAGATTAAGCAGAACTCGAGTTCTGCTTAATCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-903s21c1
Sequence:CCGGGCCACGGAAGATTAAGCAGAACTCGAGTTCTGCTTAATCTTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-714s21c1
Sequence:CCGGCCTGGTAGCTTTCAAGGCAATCTCGAGATTGCCTTGAAAGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-730s21c1
Sequence:CCGGGCAATGGACTTCCACTGGATTCTCGAGAATCCAGTGGAAGTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-357s21c1
Sequence:CCGGCCTGCGGCTTGAGGATTATTTCTCGAGAAATAATCCTCAAGCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006278
ST3GAL4 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006278.1-1415s1c1
Sequence:CCGGCCAGCACCAAGAGATTATTTACTCGAGTAAATAATCTCTTGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-714s1c1
Sequence:CCGGCCTGGTAGCTTTCAAGGCAATCTCGAGATTGCCTTGAAAGCTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-730s1c1
Sequence:CCGGGCAATGGACTTCCACTGGATTCTCGAGAATCCAGTGGAAGTCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-357s1c1
Sequence:CCGGCCTGCGGCTTGAGGATTATTTCTCGAGAAATAATCCTCAAGCCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006278.1-903s1c1
Sequence:CCGGGCCACGGAAGATTAAGCAGAACTCGAGTTCTGCTTAATCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-903s21c1
Sequence:CCGGGCCACGGAAGATTAAGCAGAACTCGAGTTCTGCTTAATCTTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-714s21c1
Sequence:CCGGCCTGGTAGCTTTCAAGGCAATCTCGAGATTGCCTTGAAAGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-730s21c1
Sequence:CCGGGCAATGGACTTCCACTGGATTCTCGAGAATCCAGTGGAAGTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006278.1-357s21c1
Sequence:CCGGCCTGCGGCTTGAGGATTATTTCTCGAGAAATAATCCTCAAGCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks