EMAIL THIS PAGE TO A FRIEND

ST3GAL5

ST3 beta-galactoside alpha-2,3-sialyltransferase 5

Synonyms: SATI SIAT9 SIATGM3S ST3GalV
Gene ID:
Human(8869) Summary: Ganglioside GM3 is known to participate in the induction of cell differentiation, modulation of cell proliferation, maintenance of fibroblast morphology, signal transduction, and integrin-mediated cell adhesion. The protein encoded by this gene is a type II membrane protein which catalyzes the formation of GM3 using lactosylceramide as the substrate. The encoded protein is a member of glycosyltransferase family 29 and may be localized to the Golgi apparatus. Mutation in this gene has been associated with Amish infantile epilepsy syndrome. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20454) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Rat(83505) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Zebrafish(394230) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Horse(100067118) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
domestic cat(101092099) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
dog(612022) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
chicken(407775) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Domestic Rabbit(100341761) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
naked mole-rat(101699085) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
domestic guinea pig(100728609) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
cow(404164) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
sheep(101104977) ST3 beta-galactoside alpha-2,3-sialyltransferase 5
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042437 Rosetta Predictions human pricing
NM_003896 Rosetta Predictions human pricing
NM_031337 Rosetta Predictions rat pricing
NM_001035228 Rosetta Predictions mouse pricing
NM_011375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309758 predicted 782
2 SASI_Hs02_00309759 predicted 659
3 SASI_Hs02_00309760 predicted 585
4 SASI_Hs02_00309761 predicted 948
5 SASI_Hs02_00309762 predicted 482
6 SASI_Hs02_00309763 predicted 354
7 SASI_Hs02_00309764 predicted 1106
8 SASI_Hs02_00309765 predicted 1086
9 SASI_Hs02_00309766 predicted 336
10 SASI_Hs02_00309767 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070865 predicted 808
2 SASI_Hs01_00070867 predicted 724
3 SASI_Hs02_00336517 predicted 1091
4 SASI_Hs01_00070868 predicted 625
5 SASI_Hs01_00070869 predicted 503
6 SASI_Hs01_00070871 predicted 1253
7 SASI_Hs01_00070872 predicted 1235
8 SASI_Hs02_00336518 predicted 480
9 SASI_Hs02_00336519 predicted 1272
10 SASI_Hs02_00336520 predicted 769
11 SASI_Hs01_00070863 predicted 360
12 SASI_Hs01_00070864 predicted 350
13 SASI_Hs01_00070866 predicted 504
14 SASI_Hs01_00070870 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095359 predicted 721
2 SASI_Rn01_00095360 predicted 1456
3 SASI_Rn01_00095361 predicted 1138
4 SASI_Rn01_00095362 predicted 1514
5 SASI_Rn01_00095363 predicted 1118
6 SASI_Rn01_00095364 predicted 1302
7 SASI_Rn01_00095365 predicted 1145
8 SASI_Rn01_00095366 predicted 872
9 SASI_Rn02_00264571 predicted 884
10 SASI_Rn01_00095367 predicted 984
11 SASI_Rn01_00095368 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050516 predicted 718
2 SASI_Mm01_00050517 predicted 839
3 SASI_Mm01_00050518 predicted 538
4 SASI_Mm01_00050519 predicted 797
5 SASI_Mm01_00050520 predicted 470
6 SASI_Mm01_00050521 predicted 1010
7 SASI_Mm02_00289256 predicted 903
8 SASI_Mm01_00050522 predicted 745
9 SASI_Mm01_00050523 predicted 620
10 SASI_Mm01_00050524 predicted 985
11 SASI_Mm01_00050515 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198115 predicted 933
2 SASI_Mm01_00198116 predicted 1045
3 SASI_Mm01_00198117 predicted 743
4 SASI_Mm01_00198118 predicted 1004
5 SASI_Mm01_00198119 predicted 680
6 SASI_Mm01_00198120 predicted 1225
7 SASI_Mm02_00320553 predicted 1106
8 SASI_Mm01_00198121 predicted 960
9 SASI_Mm01_00198122 predicted 831
10 SASI_Mm01_00198123 predicted 1198
11 SASI_Mm01_00198114 predicted 1264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003896
VALIDATED
ST3GAL5 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-1714s21c1
Sequence:CCGGCATTGAATACAGGTAACTAATCTCGAGATTAGTTACCTGTATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-1361s21c1
Sequence:CCGGGTGGAGGCATTGATCGTGAATCTCGAGATTCACGATCAATGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-451s21c1
Sequence:CCGGGCTCAGAAATATGCTCAGCAACTCGAGTTGCTGAGCATATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-874s21c1
Sequence:CCGGCCACTGTCTGACCTTGAATATCTCGAGATATTCAAGGTCAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-499s1c1
Sequence:CCGGGCTGTTATTTGAGCACAGGTACTCGAGTACCTGTGCTCAAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-854s1c1
Sequence:CCGGCCACTGTCTGACCTTGAATATCTCGAGATATTCAAGGTCAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-1341s1c1
Sequence:CCGGGTGGAGGCATTGATCGTGAATCTCGAGATTCACGATCAATGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-431s1c1
Sequence:CCGGGCTCAGAAATATGCTCAGCAACTCGAGTTGCTGAGCATATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003896.2-658s1c1
Sequence:CCGGCCCTGAACACTTGAAAGCCAACTCGAGTTGGCTTTCAAGTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003896
VALIDATED
ST3GAL5 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-1714s21c1
Sequence:CCGGCATTGAATACAGGTAACTAATCTCGAGATTAGTTACCTGTATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-1361s21c1
Sequence:CCGGGTGGAGGCATTGATCGTGAATCTCGAGATTCACGATCAATGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-451s21c1
Sequence:CCGGGCTCAGAAATATGCTCAGCAACTCGAGTTGCTGAGCATATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-874s21c1
Sequence:CCGGCCACTGTCTGACCTTGAATATCTCGAGATATTCAAGGTCAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-499s1c1
Sequence:CCGGGCTGTTATTTGAGCACAGGTACTCGAGTACCTGTGCTCAAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-854s1c1
Sequence:CCGGCCACTGTCTGACCTTGAATATCTCGAGATATTCAAGGTCAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-1341s1c1
Sequence:CCGGGTGGAGGCATTGATCGTGAATCTCGAGATTCACGATCAATGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-431s1c1
Sequence:CCGGGCTCAGAAATATGCTCAGCAACTCGAGTTGCTGAGCATATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003896.2-658s1c1
Sequence:CCGGCCCTGAACACTTGAAAGCCAACTCGAGTTGGCTTTCAAGTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003896
VALIDATED
ST3GAL5 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-1714s21c1
Sequence:CCGGCATTGAATACAGGTAACTAATCTCGAGATTAGTTACCTGTATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-1361s21c1
Sequence:CCGGGTGGAGGCATTGATCGTGAATCTCGAGATTCACGATCAATGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-451s21c1
Sequence:CCGGGCTCAGAAATATGCTCAGCAACTCGAGTTGCTGAGCATATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003896.3-874s21c1
Sequence:CCGGCCACTGTCTGACCTTGAATATCTCGAGATATTCAAGGTCAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-499s1c1
Sequence:CCGGGCTGTTATTTGAGCACAGGTACTCGAGTACCTGTGCTCAAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-854s1c1
Sequence:CCGGCCACTGTCTGACCTTGAATATCTCGAGATATTCAAGGTCAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-1341s1c1
Sequence:CCGGGTGGAGGCATTGATCGTGAATCTCGAGATTCACGATCAATGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003896.2-431s1c1
Sequence:CCGGGCTCAGAAATATGCTCAGCAACTCGAGTTGCTGAGCATATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003896.2-658s1c1
Sequence:CCGGCCCTGAACACTTGAAAGCCAACTCGAGTTGGCTTTCAAGTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011375
VALIDATED
ST3GAL5 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011375.2-1722s21c1
Sequence:CCGGTGCACCTCTTCGTCCTATTTACTCGAGTAAATAGGACGAAGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-1054s21c1
Sequence:CCGGGACGTTGAATACTACGCCAATCTCGAGATTGGCGTAGTATTCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011375.2-948s21c1
Sequence:CCGGCGATGTGGTAATAAGGTTGAACTCGAGTTCAACCTTATTACCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-564s21c1
Sequence:CCGGCGCTGAAGAATGTGACATGAACTCGAGTTCATGTCACATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011375.1-477s1c2
Sequence:CCGGCAGCATCAACTTGGAGCCTTTCTCGAGAAAGGCTCCAAGTTGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-597s21c1
Sequence:CCGGTGTGGACCCTGACCGGATAAACTCGAGTTTATCCGGTCAGGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-330s1c1
Sequence:CCGGCGCTGAAGAATGTGACATGAACTCGAGTTCATGTCACATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-714s1c1
Sequence:CCGGCGATGTGGTAATAAGGTTGAACTCGAGTTCAACCTTATTACCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-820s1c1
Sequence:CCGGGACGTTGAATACTACGCCAATCTCGAGATTGGCGTAGTATTCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011375
VALIDATED
ST3GAL5 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011375.2-1722s21c1
Sequence:CCGGTGCACCTCTTCGTCCTATTTACTCGAGTAAATAGGACGAAGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-1054s21c1
Sequence:CCGGGACGTTGAATACTACGCCAATCTCGAGATTGGCGTAGTATTCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011375.2-948s21c1
Sequence:CCGGCGATGTGGTAATAAGGTTGAACTCGAGTTCAACCTTATTACCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-564s21c1
Sequence:CCGGCGCTGAAGAATGTGACATGAACTCGAGTTCATGTCACATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011375.1-477s1c2
Sequence:CCGGCAGCATCAACTTGGAGCCTTTCTCGAGAAAGGCTCCAAGTTGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-597s21c1
Sequence:CCGGTGTGGACCCTGACCGGATAAACTCGAGTTTATCCGGTCAGGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-330s1c1
Sequence:CCGGCGCTGAAGAATGTGACATGAACTCGAGTTCATGTCACATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-714s1c1
Sequence:CCGGCGATGTGGTAATAAGGTTGAACTCGAGTTCAACCTTATTACCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-820s1c1
Sequence:CCGGGACGTTGAATACTACGCCAATCTCGAGATTGGCGTAGTATTCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011375
VALIDATED
ST3GAL5 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011375.2-1722s21c1
Sequence:CCGGTGCACCTCTTCGTCCTATTTACTCGAGTAAATAGGACGAAGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-1054s21c1
Sequence:CCGGGACGTTGAATACTACGCCAATCTCGAGATTGGCGTAGTATTCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011375.2-948s21c1
Sequence:CCGGCGATGTGGTAATAAGGTTGAACTCGAGTTCAACCTTATTACCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-564s21c1
Sequence:CCGGCGCTGAAGAATGTGACATGAACTCGAGTTCATGTCACATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011375.1-477s1c2
Sequence:CCGGCAGCATCAACTTGGAGCCTTTCTCGAGAAAGGCTCCAAGTTGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011375.2-597s21c1
Sequence:CCGGTGTGGACCCTGACCGGATAAACTCGAGTTTATCCGGTCAGGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-330s1c1
Sequence:CCGGCGCTGAAGAATGTGACATGAACTCGAGTTCATGTCACATTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-714s1c1
Sequence:CCGGCGATGTGGTAATAAGGTTGAACTCGAGTTCAACCTTATTACCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011375.1-820s1c1
Sequence:CCGGGACGTTGAATACTACGCCAATCTCGAGATTGGCGTAGTATTCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks