EMAIL THIS PAGE TO A FRIEND

ST3GAL6

ST3 beta-galactoside alpha-2,3-sialyltransferase 6

Synonyms: SIAT10 ST3GALVI
UniProtKB ID: Q9Y274, B2RCH2, B3KMI1, D3DN39, F8W6U0
Gene ID:
Human(10402) Summary: The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Mouse(54613) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Rat(304023) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
chicken(395138) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
dog(478535) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
domestic cat(101091552) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
cow(444860) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
sheep(101106812) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
domestic guinea pig(100734435) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
naked mole-rat(101706310) ST3 beta-galactoside alpha-2,3-sialyltransferase 6
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006100 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010221 MISSION® esiRNA esiRNA targeting human ST3GAL6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006100 Rosetta Predictions human pricing
NM_207602 Rosetta Predictions rat pricing
NM_018784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112104 predicted 1436
2 SASI_Hs01_00112105 predicted 1170
3 SASI_Hs01_00112106 predicted 1130
4 SASI_Hs01_00112107 predicted 1450
5 SASI_Hs01_00112108 predicted 1139
6 SASI_Hs01_00112109 predicted 1162
7 SASI_Hs01_00112110 predicted 1479
8 SASI_Hs01_00112111 predicted 989
9 SASI_Hs01_00112112 predicted 1437
10 SASI_Hs01_00112113 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035725 predicted 1131
2 SASI_Rn01_00035726 predicted 306
3 SASI_Rn01_00035727 predicted 1148
4 SASI_Rn02_00270427 predicted 371
5 SASI_Rn01_00035728 predicted 269
6 SASI_Rn01_00035729 predicted 1304
7 SASI_Rn01_00035731 predicted 441
8 SASI_Rn01_00035732 predicted 1163
9 SASI_Rn01_00035733 predicted 655
10 SASI_Rn01_00035734 predicted 547
11 SASI_Rn01_00035730 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074562 predicted 633
2 SASI_Mm01_00074563 predicted 1274
3 SASI_Mm01_00074564 predicted 1088
4 SASI_Mm01_00074565 predicted 922
5 SASI_Mm01_00074566 predicted 747
6 SASI_Mm01_00074567 predicted 517
7 SASI_Mm01_00074568 predicted 497
8 SASI_Mm01_00074569 predicted 1285
9 SASI_Mm02_00324097 predicted 1253
10 SASI_Mm01_00074570 predicted 1144
11 SASI_Mm01_00074571 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018784
VALIDATED
ST3GAL6 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018784.1-1362s1c1
Sequence:CCGGCCTTTACACTACTACGGGAATCTCGAGATTCCCGTAGTAGTGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-1089s1c1
Sequence:CCGGGTGGAAATACTGCTAGGTAAACTCGAGTTTACCTAGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-605s1c1
Sequence:CCGGGAGGACTAGAAACAATGTCAACTCGAGTTGACATTGTTTCTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018784.1-1296s1c1
Sequence:CCGGGCCTTTCACATATGCAGTGAACTCGAGTTCACTGCATATGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-897s1c1
Sequence:CCGGGCAACAATTGACTCCTATGATCTCGAGATCATAGGAGTCAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-897s21c1
Sequence:CCGGGCAACAATTGACTCCTATGATCTCGAGATCATAGGAGTCAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-605s21c1
Sequence:CCGGGAGGACTAGAAACAATGTCAACTCGAGTTGACATTGTTTCTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1296s21c1
Sequence:CCGGGCCTTTCACATATGCAGTGAACTCGAGTTCACTGCATATGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1362s21c1
Sequence:CCGGCCTTTACACTACTACGGGAATCTCGAGATTCCCGTAGTAGTGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1089s21c1
Sequence:CCGGGTGGAAATACTGCTAGGTAAACTCGAGTTTACCTAGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018784
VALIDATED
ST3GAL6 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018784.1-1362s1c1
Sequence:CCGGCCTTTACACTACTACGGGAATCTCGAGATTCCCGTAGTAGTGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-1089s1c1
Sequence:CCGGGTGGAAATACTGCTAGGTAAACTCGAGTTTACCTAGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-605s1c1
Sequence:CCGGGAGGACTAGAAACAATGTCAACTCGAGTTGACATTGTTTCTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018784.1-1296s1c1
Sequence:CCGGGCCTTTCACATATGCAGTGAACTCGAGTTCACTGCATATGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-897s1c1
Sequence:CCGGGCAACAATTGACTCCTATGATCTCGAGATCATAGGAGTCAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-897s21c1
Sequence:CCGGGCAACAATTGACTCCTATGATCTCGAGATCATAGGAGTCAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-605s21c1
Sequence:CCGGGAGGACTAGAAACAATGTCAACTCGAGTTGACATTGTTTCTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1296s21c1
Sequence:CCGGGCCTTTCACATATGCAGTGAACTCGAGTTCACTGCATATGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1362s21c1
Sequence:CCGGCCTTTACACTACTACGGGAATCTCGAGATTCCCGTAGTAGTGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1089s21c1
Sequence:CCGGGTGGAAATACTGCTAGGTAAACTCGAGTTTACCTAGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018784
VALIDATED
ST3GAL6 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018784.1-1362s1c1
Sequence:CCGGCCTTTACACTACTACGGGAATCTCGAGATTCCCGTAGTAGTGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-1089s1c1
Sequence:CCGGGTGGAAATACTGCTAGGTAAACTCGAGTTTACCTAGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-605s1c1
Sequence:CCGGGAGGACTAGAAACAATGTCAACTCGAGTTGACATTGTTTCTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018784.1-1296s1c1
Sequence:CCGGGCCTTTCACATATGCAGTGAACTCGAGTTCACTGCATATGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018784.1-897s1c1
Sequence:CCGGGCAACAATTGACTCCTATGATCTCGAGATCATAGGAGTCAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-897s21c1
Sequence:CCGGGCAACAATTGACTCCTATGATCTCGAGATCATAGGAGTCAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-605s21c1
Sequence:CCGGGAGGACTAGAAACAATGTCAACTCGAGTTGACATTGTTTCTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1296s21c1
Sequence:CCGGGCCTTTCACATATGCAGTGAACTCGAGTTCACTGCATATGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1362s21c1
Sequence:CCGGCCTTTACACTACTACGGGAATCTCGAGATTCCCGTAGTAGTGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018784.2-1089s21c1
Sequence:CCGGGTGGAAATACTGCTAGGTAAACTCGAGTTTACCTAGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006100
VALIDATED
ST3GAL6 MISSION shRNA Bacterial Glycerol Stock
ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1012s1c1
Sequence:CCGGCGACAGTGATTCTCACTGCTTCTCGAGAAGCAGTGAGAATCACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006100.2-508s1c1
Sequence:CCGGTCCTCTATTATGTACTGCATTCTCGAGAATGCAGTACATAATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-725s1c1
Sequence:CCGGGATGAGAACATCAGCGGAATACTCGAGTATTCCGCTGATGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1110s1c1
Sequence:CCGGCCAGCCTTAAACCTGATTTATCTCGAGATAAATCAGGTTTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1332s1c1
Sequence:CCGGCCTTTGCACTACTATGGGAATCTCGAGATTCCCATAGTAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-725s21c1
Sequence:CCGGGATGAGAACATCAGCGGAATACTCGAGTATTCCGCTGATGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-508s21c1
Sequence:CCGGTCCTCTATTATGTACTGCATTCTCGAGAATGCAGTACATAATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1012s21c1
Sequence:CCGGCGACAGTGATTCTCACTGCTTCTCGAGAAGCAGTGAGAATCACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1110s21c1
Sequence:CCGGCCAGCCTTAAACCTGATTTATCTCGAGATAAATCAGGTTTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1332s21c1
Sequence:CCGGCCTTTGCACTACTATGGGAATCTCGAGATTCCCATAGTAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006100
VALIDATED
ST3GAL6 MISSION shRNA shRNA Plasmid DNA
ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1012s1c1
Sequence:CCGGCGACAGTGATTCTCACTGCTTCTCGAGAAGCAGTGAGAATCACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006100.2-508s1c1
Sequence:CCGGTCCTCTATTATGTACTGCATTCTCGAGAATGCAGTACATAATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-725s1c1
Sequence:CCGGGATGAGAACATCAGCGGAATACTCGAGTATTCCGCTGATGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1110s1c1
Sequence:CCGGCCAGCCTTAAACCTGATTTATCTCGAGATAAATCAGGTTTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1332s1c1
Sequence:CCGGCCTTTGCACTACTATGGGAATCTCGAGATTCCCATAGTAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-725s21c1
Sequence:CCGGGATGAGAACATCAGCGGAATACTCGAGTATTCCGCTGATGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-508s21c1
Sequence:CCGGTCCTCTATTATGTACTGCATTCTCGAGAATGCAGTACATAATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1012s21c1
Sequence:CCGGCGACAGTGATTCTCACTGCTTCTCGAGAAGCAGTGAGAATCACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1110s21c1
Sequence:CCGGCCAGCCTTAAACCTGATTTATCTCGAGATAAATCAGGTTTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1332s21c1
Sequence:CCGGCCTTTGCACTACTATGGGAATCTCGAGATTCCCATAGTAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006100
VALIDATED
ST3GAL6 MISSION shRNA Lentiviral Transduction Particles
ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1012s1c1
Sequence:CCGGCGACAGTGATTCTCACTGCTTCTCGAGAAGCAGTGAGAATCACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006100.2-508s1c1
Sequence:CCGGTCCTCTATTATGTACTGCATTCTCGAGAATGCAGTACATAATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-725s1c1
Sequence:CCGGGATGAGAACATCAGCGGAATACTCGAGTATTCCGCTGATGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1110s1c1
Sequence:CCGGCCAGCCTTAAACCTGATTTATCTCGAGATAAATCAGGTTTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006100.2-1332s1c1
Sequence:CCGGCCTTTGCACTACTATGGGAATCTCGAGATTCCCATAGTAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-725s21c1
Sequence:CCGGGATGAGAACATCAGCGGAATACTCGAGTATTCCGCTGATGTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-508s21c1
Sequence:CCGGTCCTCTATTATGTACTGCATTCTCGAGAATGCAGTACATAATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1012s21c1
Sequence:CCGGCGACAGTGATTCTCACTGCTTCTCGAGAAGCAGTGAGAATCACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1110s21c1
Sequence:CCGGCCAGCCTTAAACCTGATTTATCTCGAGATAAATCAGGTTTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006100.2-1332s21c1
Sequence:CCGGCCTTTGCACTACTATGGGAATCTCGAGATTCCCATAGTAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks