EMAIL THIS PAGE TO A FRIEND

ST5

suppression of tumorigenicity 5

Synonyms: DENND2B HTS1 p126
Gene ID:
Human(6764) Summary: This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Mouse(76954) suppression of tumorigenicity 5
Rat(308944) suppression of tumorigenicity 5
Zebrafish(323827) suppression of tumorigenicity 5
Horse(100055513) suppression of tumorigenicity 5
chicken(423055) suppression of tumorigenicity 5
dog(485380) suppression of tumorigenicity 5
domestic cat(101084477) suppression of tumorigenicity 5
naked mole-rat(101725285) suppression of tumorigenicity 5
Domestic Rabbit(100343783) suppression of tumorigenicity 5
domestic guinea pig(100732063) suppression of tumorigenicity 5
cow(537907) suppression of tumorigenicity 5
sheep(101107989) suppression of tumorigenicity 5
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005418 Rosetta Predictions human pricing
NM_139157 Rosetta Predictions human pricing
NM_213618 Rosetta Predictions human pricing
NM_001107547 Rosetta Predictions rat pricing
NM_001001326 Rosetta Predictions mouse pricing
NM_029811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055442 predicted 3333
2 SASI_Hs01_00055443 predicted 3655
3 SASI_Hs01_00055444 predicted 3789
4 SASI_Hs01_00055445 predicted 3466
5 SASI_Hs01_00055446 predicted 2949
6 SASI_Hs01_00055447 predicted 2235
7 SASI_Hs01_00055449 predicted 2851
8 SASI_Hs01_00055450 predicted 2852
9 SASI_Hs01_00055451 predicted 3621
10 SASI_Hs02_00339557 predicted 2247
11 SASI_Hs01_00055448 predicted 2664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086160 predicted 1810
2 SASI_Hs01_00086161 predicted 2118
3 SASI_Hs01_00086162 predicted 2252
4 SASI_Hs01_00086163 predicted 1932
5 SASI_Hs01_00086164 predicted 1415
6 SASI_Hs01_00086165 predicted 705
7 SASI_Hs01_00086167 predicted 1316
8 SASI_Hs01_00086168 predicted 1321
9 SASI_Hs01_00086169 predicted 2089
10 SASI_Hs02_00364165 predicted 710
11 SASI_Hs01_00086166 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148172 predicted 3139
2 SASI_Hs01_00148173 predicted 3454
3 SASI_Hs01_00148174 predicted 3586
4 SASI_Hs01_00148175 predicted 3267
5 SASI_Hs01_00148176 predicted 2743
6 SASI_Hs01_00148177 predicted 2035
7 SASI_Hs01_00148179 predicted 2646
8 SASI_Hs01_00148180 predicted 2652
9 SASI_Hs01_00148181 predicted 3419
10 SASI_Hs02_00374303 predicted 2049
11 SASI_Hs01_00148178 predicted 2462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229905 predicted 478
2 SASI_Rn02_00229906 predicted 1686
3 SASI_Rn02_00229907 predicted 3146
4 SASI_Rn02_00229908 predicted 2895
5 SASI_Rn02_00229909 predicted 3483
6 SASI_Rn02_00229910 predicted 3239
7 SASI_Rn02_00229911 predicted 2075
8 SASI_Rn02_00229912 predicted 1786
9 SASI_Rn02_00229913 predicted 3592
10 SASI_Rn02_00229914 predicted 2853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178776 predicted 2813
2 SASI_Mm01_00178777 predicted 3375
3 SASI_Mm01_00178778 predicted 2820
4 SASI_Mm01_00178779 predicted 3153
5 SASI_Mm01_00178780 predicted 2668
6 SASI_Mm01_00178781 predicted 2764
7 SASI_Mm02_00286127 predicted 3332
8 SASI_Mm01_00178782 predicted 2679
9 SASI_Mm01_00178783 predicted 3485
10 SASI_Mm01_00178784 predicted 2648
11 SASI_Mm01_00178775 predicted 3191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098531 predicted 1562
2 SASI_Mm01_00098532 predicted 2118
3 SASI_Mm01_00098533 predicted 1562
4 SASI_Mm01_00098534 predicted 1909
5 SASI_Mm01_00098535 predicted 1415
6 SASI_Mm01_00098536 predicted 1512
7 SASI_Mm02_00335983 predicted 2081
8 SASI_Mm01_00098537 predicted 1421
9 SASI_Mm01_00098538 predicted 2226
10 SASI_Mm01_00098539 predicted 1390
11 SASI_Mm01_00098530 predicted 1942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005418
ST5 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-2294s21c1
Sequence:CCGGGTCTATGTCCAGCATTGAAACCTCGAGGTTTCAATGCTGGACATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-1886s21c1
Sequence:CCGGATATGAGGATGTGGACTTAAACTCGAGTTTAAGTCCACATCCTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-3691s21c1
Sequence:CCGGAGCGAGTGGAGCAGTACTTAGCTCGAGCTAAGTACTGCTCCACTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-1318s1c1
Sequence:CCGGCCCAAGAGTAAGCCCAGTAATCTCGAGATTACTGGGCTTACTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-407s1c1
Sequence:CCGGGCTTCGGTTATTTGGACAGAACTCGAGTTCTGTCCAAATAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-1965s1c1
Sequence:CCGGCCAAAGAATTAACTCCATCTACTCGAGTAGATGGAGTTAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-2580s1c1
Sequence:CCGGCGCTGCATTGGTCTATCCTTTCTCGAGAAAGGATAGACCAATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-3384s1c1
Sequence:CCGGGCTAAGAAAGTGTCGGGCAAACTCGAGTTTGCCCGACACTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005418
ST5 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-2294s21c1
Sequence:CCGGGTCTATGTCCAGCATTGAAACCTCGAGGTTTCAATGCTGGACATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-1886s21c1
Sequence:CCGGATATGAGGATGTGGACTTAAACTCGAGTTTAAGTCCACATCCTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-3691s21c1
Sequence:CCGGAGCGAGTGGAGCAGTACTTAGCTCGAGCTAAGTACTGCTCCACTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-1318s1c1
Sequence:CCGGCCCAAGAGTAAGCCCAGTAATCTCGAGATTACTGGGCTTACTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-407s1c1
Sequence:CCGGGCTTCGGTTATTTGGACAGAACTCGAGTTCTGTCCAAATAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-1965s1c1
Sequence:CCGGCCAAAGAATTAACTCCATCTACTCGAGTAGATGGAGTTAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-2580s1c1
Sequence:CCGGCGCTGCATTGGTCTATCCTTTCTCGAGAAAGGATAGACCAATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-3384s1c1
Sequence:CCGGGCTAAGAAAGTGTCGGGCAAACTCGAGTTTGCCCGACACTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005418
ST5 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-2294s21c1
Sequence:CCGGGTCTATGTCCAGCATTGAAACCTCGAGGTTTCAATGCTGGACATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-1886s21c1
Sequence:CCGGATATGAGGATGTGGACTTAAACTCGAGTTTAAGTCCACATCCTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005418.3-3691s21c1
Sequence:CCGGAGCGAGTGGAGCAGTACTTAGCTCGAGCTAAGTACTGCTCCACTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-1318s1c1
Sequence:CCGGCCCAAGAGTAAGCCCAGTAATCTCGAGATTACTGGGCTTACTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-407s1c1
Sequence:CCGGGCTTCGGTTATTTGGACAGAACTCGAGTTCTGTCCAAATAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-1965s1c1
Sequence:CCGGCCAAAGAATTAACTCCATCTACTCGAGTAGATGGAGTTAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-2580s1c1
Sequence:CCGGCGCTGCATTGGTCTATCCTTTCTCGAGAAAGGATAGACCAATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005418.2-3384s1c1
Sequence:CCGGGCTAAGAAAGTGTCGGGCAAACTCGAGTTTGCCCGACACTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001326
ST5 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-3481s1c1
Sequence:CCGGCCTGGGCAACAAGATGAAGTTCTCGAGAACTTCATCTTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001326.1-3646s1c1
Sequence:CCGGCCTTCACCATATTCCAGGATACTCGAGTATCCTGGAATATGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-2251s1c1
Sequence:CCGGCCCTGAAGTCTCCTATCAGTTCTCGAGAACTGATAGGAGACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-2756s1c1
Sequence:CCGGCGTCAGCTTATCCGAATCTTTCTCGAGAAAGATTCGGATAAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-1310s1c1
Sequence:CCGGCCTAAGACTAAGCCAAGCAATCTCGAGATTGCTTGGCTTAGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001326
ST5 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-3481s1c1
Sequence:CCGGCCTGGGCAACAAGATGAAGTTCTCGAGAACTTCATCTTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001326.1-3646s1c1
Sequence:CCGGCCTTCACCATATTCCAGGATACTCGAGTATCCTGGAATATGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-2251s1c1
Sequence:CCGGCCCTGAAGTCTCCTATCAGTTCTCGAGAACTGATAGGAGACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-2756s1c1
Sequence:CCGGCGTCAGCTTATCCGAATCTTTCTCGAGAAAGATTCGGATAAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-1310s1c1
Sequence:CCGGCCTAAGACTAAGCCAAGCAATCTCGAGATTGCTTGGCTTAGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001326
ST5 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-3481s1c1
Sequence:CCGGCCTGGGCAACAAGATGAAGTTCTCGAGAACTTCATCTTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001326.1-3646s1c1
Sequence:CCGGCCTTCACCATATTCCAGGATACTCGAGTATCCTGGAATATGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-2251s1c1
Sequence:CCGGCCCTGAAGTCTCCTATCAGTTCTCGAGAACTGATAGGAGACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-2756s1c1
Sequence:CCGGCGTCAGCTTATCCGAATCTTTCTCGAGAAAGATTCGGATAAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001326.1-1310s1c1
Sequence:CCGGCCTAAGACTAAGCCAAGCAATCTCGAGATTGCTTGGCTTAGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks