EMAIL THIS PAGE TO A FRIEND

ST6GAL1

ST6 beta-galactosamide alpha-2,6-sialyltranferase 1

Synonyms: SIAT1 ST6GalI ST6N
UniProtKB ID: P15907, A8KA14, D3DNV3
Gene ID:
Human(6480) Summary: This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Three transcript variants encoding two different isoforms have been described. [provided by RefSeq, Aug 2009]
Mouse(20440) beta galactoside alpha 2,6 sialyltransferase 1
Rat(25197) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Zebrafish(445376) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
dog(478668) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
chicken(396169) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
domestic cat(101097832) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Horse(100059539) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
cow(282073) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
sheep(100913159) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Goat(100861310) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
domestic guinea pig(100730025) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Domestic Rabbit(100353188) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
naked mole-rat(101718025) ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
211 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1722 Human ST6GAL1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003032 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003032 Rosetta Predictions human pricing
NM_173216 Rosetta Predictions human pricing
NM_173217 Rosetta Predictions human pricing
NM_001113344 Rosetta Predictions rat pricing
NM_147205 Rosetta Predictions rat pricing
NM_145933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058621 predicted 1903
2 SASI_Hs01_00058622 predicted 1469
3 SASI_Hs02_00334935 predicted 1539
4 SASI_Hs01_00058623 predicted 1242
5 SASI_Hs01_00058624 predicted 1879
6 SASI_Hs01_00058625 predicted 1796
7 SASI_Hs01_00058626 predicted 1556
8 SASI_Hs01_00058627 predicted 1756
9 SASI_Hs01_00058628 predicted 1359
10 SASI_Hs01_00058629 predicted 1895
11 SASI_Hs01_00058630 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193627 predicted 2023
2 SASI_Hs01_00193628 predicted 1588
3 SASI_Hs02_00368173 predicted 1660
4 SASI_Hs01_00193629 predicted 1362
5 SASI_Hs01_00193630 predicted 2004
6 SASI_Hs01_00193631 predicted 1923
7 SASI_Hs01_00193632 predicted 1678
8 SASI_Hs01_00193633 predicted 1874
9 SASI_Hs01_00193634 predicted 1483
10 SASI_Hs01_00193635 predicted 2015
11 SASI_Hs01_00193636 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150582 predicted 1367
2 SASI_Hs01_00150583 predicted 939
3 SASI_Hs02_00368174 predicted 1007
4 SASI_Hs01_00150584 predicted 708
5 SASI_Hs01_00150585 predicted 1340
6 SASI_Hs01_00150586 predicted 1260
7 SASI_Hs01_00150587 predicted 1014
8 SASI_Hs01_00150588 predicted 1223
9 SASI_Hs01_00150589 predicted 823
10 SASI_Hs01_00150590 predicted 1354
11 SASI_Hs01_00150591 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251733 predicted 1311
2 SASI_Rn02_00251734 predicted 1491
3 SASI_Rn02_00251735 predicted 1079
4 SASI_Rn02_00251736 predicted 1856
5 SASI_Rn02_00251737 predicted 1852
6 SASI_Rn02_00251738 predicted 1740
7 SASI_Rn02_00251739 predicted 1174
8 SASI_Rn02_00251740 predicted 1721
9 SASI_Rn02_00251741 predicted 1376
10 SASI_Rn02_00251742 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268872 predicted 665
2 SASI_Rn02_00268873 predicted 852
3 SASI_Rn01_00086485 predicted 441
4 SASI_Rn02_00268874 predicted 1211
5 SASI_Rn02_00268875 predicted 1201
6 SASI_Rn02_00268876 predicted 1098
7 SASI_Rn02_00268877 predicted 527
8 SASI_Rn02_00268878 predicted 1074
9 SASI_Rn01_00086487 predicted 724
10 SASI_Rn02_00268879 predicted 913
11 SASI_Rn01_00086486 predicted 314
12 SASI_Rn01_00086488 predicted 313
13 SASI_Rn01_00086489 predicted 278
14 SASI_Rn01_00086490 predicted 360
15 SASI_Rn01_00086491 predicted 800
16 SASI_Rn01_00086492 predicted 286
17 SASI_Rn01_00086493 predicted 1000
18 SASI_Rn01_00086494 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099089 predicted 1120
2 SASI_Mm01_00099090 predicted 824
3 SASI_Mm01_00099091 predicted 1601
4 SASI_Mm01_00099092 predicted 1178
5 SASI_Mm02_00341387 predicted 1938
6 SASI_Mm01_00099093 predicted 1222
7 SASI_Mm01_00099094 predicted 1124
8 SASI_Mm01_00099095 predicted 1228
9 SASI_Mm01_00099096 predicted 991
10 SASI_Mm01_00099097 predicted 1718
11 SASI_Mm01_00099088 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003032
ST6GAL1 MISSION shRNA Bacterial Glycerol Stock
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1363s1c1
Sequence:CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1033s1c1
Sequence:CCGGGCGCTTCCTCAAAGACAGTTTCTCGAGAAACTGTCTTTGAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1422s1c1
Sequence:CCGGCGCTGCTCTATGAGAAGAATTCTCGAGAATTCTTCTCATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-658s1c1
Sequence:CCGGCCTAAGCATGAACAAGTACAACTCGAGTTGTACTTGTTCATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1246s1c1
Sequence:CCGGCCCAGAAGAGATTCAGCCAAACTCGAGTTTGGCTGAATCTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003032.2-926s21c1
Sequence:CCGGGACGCAGTCCTGAGGTTTAATCTCGAGATTAAACCTCAGGACTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003032.2-1117s21c1
Sequence:CCGGGTACCAGAATCCGGATTATAACTCGAGTTATAATCCGGATTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003032.2-1886s21c1
Sequence:CCGGCACAAACCAATGCTCTATATTCTCGAGAATATAGAGCATTGGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003032
ST6GAL1 MISSION shRNA shRNA Plasmid DNA
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1363s1c1
Sequence:CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1033s1c1
Sequence:CCGGGCGCTTCCTCAAAGACAGTTTCTCGAGAAACTGTCTTTGAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1422s1c1
Sequence:CCGGCGCTGCTCTATGAGAAGAATTCTCGAGAATTCTTCTCATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-658s1c1
Sequence:CCGGCCTAAGCATGAACAAGTACAACTCGAGTTGTACTTGTTCATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1246s1c1
Sequence:CCGGCCCAGAAGAGATTCAGCCAAACTCGAGTTTGGCTGAATCTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003032.2-926s21c1
Sequence:CCGGGACGCAGTCCTGAGGTTTAATCTCGAGATTAAACCTCAGGACTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003032.2-1117s21c1
Sequence:CCGGGTACCAGAATCCGGATTATAACTCGAGTTATAATCCGGATTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003032.2-1886s21c1
Sequence:CCGGCACAAACCAATGCTCTATATTCTCGAGAATATAGAGCATTGGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003032
ST6GAL1 MISSION shRNA Lentiviral Transduction Particles
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1363s1c1
Sequence:CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1033s1c1
Sequence:CCGGGCGCTTCCTCAAAGACAGTTTCTCGAGAAACTGTCTTTGAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1422s1c1
Sequence:CCGGCGCTGCTCTATGAGAAGAATTCTCGAGAATTCTTCTCATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-658s1c1
Sequence:CCGGCCTAAGCATGAACAAGTACAACTCGAGTTGTACTTGTTCATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003032.2-1246s1c1
Sequence:CCGGCCCAGAAGAGATTCAGCCAAACTCGAGTTTGGCTGAATCTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003032.2-926s21c1
Sequence:CCGGGACGCAGTCCTGAGGTTTAATCTCGAGATTAAACCTCAGGACTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003032.2-1117s21c1
Sequence:CCGGGTACCAGAATCCGGATTATAACTCGAGTTATAATCCGGATTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003032.2-1886s21c1
Sequence:CCGGCACAAACCAATGCTCTATATTCTCGAGAATATAGAGCATTGGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145933
VALIDATED
ST6GAL1 MISSION shRNA Bacterial Glycerol Stock
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1240s1c1
Sequence:CCGGCGAGAGATTGATAATCATGATCTCGAGATCATGATTATCAATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1579s1c1
Sequence:CCGGCCAGATCTGATTCAGCCGAATCTCGAGATTCGGCTGAATCAGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1754s1c1
Sequence:CCGGCGCTCCTCTTCGAGAAGAATACTCGAGTATTCTTCTCGAAGAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1650s1c1
Sequence:CCGGCCAAGTTGATATTTACGAGTTCTCGAGAACTCGTAAATATCAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1459s1c1
Sequence:CCGGCCAGACTACAACTTCTTCGAACTCGAGTTCGAAGAAGTTGTAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1602s21c1
Sequence:CCGGCCAGACTACAACTTCTTCGAACTCGAGTTCGAAGAAGTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1897s21c1
Sequence:CCGGCGCTCCTCTTCGAGAAGAATACTCGAGTATTCTTCTCGAAGAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1383s21c1
Sequence:CCGGCGAGAGATTGATAATCATGATCTCGAGATCATGATTATCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1722s21c1
Sequence:CCGGCCAGATCTGATTCAGCCGAATCTCGAGATTCGGCTGAATCAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1793s21c1
Sequence:CCGGCCAAGTTGATATTTACGAGTTCTCGAGAACTCGTAAATATCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145933
VALIDATED
ST6GAL1 MISSION shRNA shRNA Plasmid DNA
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1240s1c1
Sequence:CCGGCGAGAGATTGATAATCATGATCTCGAGATCATGATTATCAATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1579s1c1
Sequence:CCGGCCAGATCTGATTCAGCCGAATCTCGAGATTCGGCTGAATCAGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1754s1c1
Sequence:CCGGCGCTCCTCTTCGAGAAGAATACTCGAGTATTCTTCTCGAAGAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1650s1c1
Sequence:CCGGCCAAGTTGATATTTACGAGTTCTCGAGAACTCGTAAATATCAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1459s1c1
Sequence:CCGGCCAGACTACAACTTCTTCGAACTCGAGTTCGAAGAAGTTGTAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1602s21c1
Sequence:CCGGCCAGACTACAACTTCTTCGAACTCGAGTTCGAAGAAGTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1897s21c1
Sequence:CCGGCGCTCCTCTTCGAGAAGAATACTCGAGTATTCTTCTCGAAGAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1383s21c1
Sequence:CCGGCGAGAGATTGATAATCATGATCTCGAGATCATGATTATCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1722s21c1
Sequence:CCGGCCAGATCTGATTCAGCCGAATCTCGAGATTCGGCTGAATCAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1793s21c1
Sequence:CCGGCCAAGTTGATATTTACGAGTTCTCGAGAACTCGTAAATATCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145933
VALIDATED
ST6GAL1 MISSION shRNA Lentiviral Transduction Particles
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1240s1c1
Sequence:CCGGCGAGAGATTGATAATCATGATCTCGAGATCATGATTATCAATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1579s1c1
Sequence:CCGGCCAGATCTGATTCAGCCGAATCTCGAGATTCGGCTGAATCAGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1754s1c1
Sequence:CCGGCGCTCCTCTTCGAGAAGAATACTCGAGTATTCTTCTCGAAGAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1650s1c1
Sequence:CCGGCCAAGTTGATATTTACGAGTTCTCGAGAACTCGTAAATATCAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145933.2-1459s1c1
Sequence:CCGGCCAGACTACAACTTCTTCGAACTCGAGTTCGAAGAAGTTGTAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1602s21c1
Sequence:CCGGCCAGACTACAACTTCTTCGAACTCGAGTTCGAAGAAGTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1897s21c1
Sequence:CCGGCGCTCCTCTTCGAGAAGAATACTCGAGTATTCTTCTCGAAGAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1383s21c1
Sequence:CCGGCGAGAGATTGATAATCATGATCTCGAGATCATGATTATCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1722s21c1
Sequence:CCGGCCAGATCTGATTCAGCCGAATCTCGAGATTCGGCTGAATCAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145933.3-1793s21c1
Sequence:CCGGCCAAGTTGATATTTACGAGTTCTCGAGAACTCGTAAATATCAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks