EMAIL THIS PAGE TO A FRIEND

ST6GAL2

ST6 beta-galactosamide alpha-2,6-sialyltranferase 2

Synonyms: SIAT2 ST6GalII
UniProtKB ID: Q96JF0, D3DVK3, Q53QP4, Q86Y44, Q8IUG7, Q96HE4
Gene ID:
Human(84620) Summary: This locus encodes a sialyltransferase. The encoded type II transmembrane protein catalyzes the transfer of sialic acid from CMP to an oligosaccharide substrate. Polymorphisms at this locus may be associated with variations in risperidone response in schizophrenic patients. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Mouse(240119) beta galactoside alpha 2,6 sialyltransferase 2
Rat(301155) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
naked mole-rat(101722644) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Domestic Rabbit(100358153) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
domestic guinea pig(100728814) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
cow(493992) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
sheep(101108300) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
chicken(403122) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
domestic cat(101098620) ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017891 MISSION® esiRNA esiRNA targeting mouse St6gal2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032528 Rosetta Predictions human pricing
XM_001058146 Rosetta Predictions rat pricing
XM_236826 Rosetta Predictions rat pricing
NM_172829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048130 predicted 1194
2 SASI_Hs01_00048131 predicted 477
3 SASI_Hs01_00048132 predicted 481
4 SASI_Hs01_00048133 predicted 1454
5 SASI_Hs01_00048134 predicted 708
6 SASI_Hs02_00360027 predicted 1296
7 SASI_Hs01_00048135 predicted 472
8 SASI_Hs01_00048137 predicted 1168
9 SASI_Hs01_00048138 predicted 1329
10 SASI_Hs01_00048139 predicted 1185
11 SASI_Hs01_00048136 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288745 predicted 1314
2 SASI_Rn02_00288746 predicted 1184
3 SASI_Rn02_00288747 predicted 302
4 SASI_Rn02_00288748 predicted 1752
5 SASI_Rn02_00288749 predicted 238
6 SASI_Rn02_00288750 predicted 1818
7 SASI_Rn02_00288751 predicted 1185
8 SASI_Rn02_00288752 predicted 1310
9 SASI_Rn02_00288753 predicted 1339
10 SASI_Rn02_00288754 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171163 predicted 1313
2 SASI_Rn01_00171164 predicted 1182
3 SASI_Rn01_00171165 predicted 300
4 SASI_Rn01_00171166 predicted 1210
5 SASI_Rn01_00171167 predicted 239
6 SASI_Rn01_00171168 predicted 1187
7 SASI_Rn01_00171169 predicted 1308
8 SASI_Rn01_00171170 predicted 1339
9 SASI_Rn01_00171171 predicted 515
10 SASI_Rn01_00171172 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116697 predicted 1124
2 SASI_Mm01_00116699 predicted 1524
3 SASI_Mm01_00116700 predicted 617
4 SASI_Mm01_00116701 predicted 1133
5 SASI_Mm01_00116702 predicted 1277
6 SASI_Mm01_00116703 predicted 1567
7 SASI_Mm01_00116704 predicted 1199
8 SASI_Mm01_00116705 predicted 1260
9 SASI_Mm01_00116706 predicted 503
10 SASI_Mm02_00344760 predicted 1565
11 SASI_Mm01_00116698 predicted 1477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032528
ST6GAL2 MISSION shRNA Bacterial Glycerol Stock
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032528.2-1631s21c1
Sequence:CCGGCGTACCACCCACTACTCTATGCTCGAGCATAGAGTAGTGGGTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032528.2-1893s21c1
Sequence:CCGGATTTAGTGGTGGTCATGATAACTCGAGTTATCATGACCACCACTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032528.2-2170s21c1
Sequence:CCGGTCAAATTGAGGGACATCATTTCTCGAGAAATGATGTCCCTCAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1303s1c1
Sequence:CCGGCGCAAATCTTAACCTGTGGTACTCGAGTACCACAGGTTAAGATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1160s1c1
Sequence:CCGGCGTGGTTATGAGAAAGATGTTCTCGAGAACATCTTTCTCATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1199s1c1
Sequence:CCGGCGCATCATTAATTCGCAGATTCTCGAGAATCTGCGAATTAATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-476s1c1
Sequence:CCGGCAGTCCCAAGATGGGTTTGAACTCGAGTTCAAACCCATCTTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1363s1c1
Sequence:CCGGGCATCGTCAGAGAAACCCAAACTCGAGTTTGGGTTTCTCTGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032528
ST6GAL2 MISSION shRNA shRNA Plasmid DNA
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032528.2-1631s21c1
Sequence:CCGGCGTACCACCCACTACTCTATGCTCGAGCATAGAGTAGTGGGTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032528.2-1893s21c1
Sequence:CCGGATTTAGTGGTGGTCATGATAACTCGAGTTATCATGACCACCACTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032528.2-2170s21c1
Sequence:CCGGTCAAATTGAGGGACATCATTTCTCGAGAAATGATGTCCCTCAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1303s1c1
Sequence:CCGGCGCAAATCTTAACCTGTGGTACTCGAGTACCACAGGTTAAGATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1160s1c1
Sequence:CCGGCGTGGTTATGAGAAAGATGTTCTCGAGAACATCTTTCTCATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1199s1c1
Sequence:CCGGCGCATCATTAATTCGCAGATTCTCGAGAATCTGCGAATTAATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-476s1c1
Sequence:CCGGCAGTCCCAAGATGGGTTTGAACTCGAGTTCAAACCCATCTTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1363s1c1
Sequence:CCGGGCATCGTCAGAGAAACCCAAACTCGAGTTTGGGTTTCTCTGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032528
ST6GAL2 MISSION shRNA Lentiviral Transduction Particles
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032528.2-1631s21c1
Sequence:CCGGCGTACCACCCACTACTCTATGCTCGAGCATAGAGTAGTGGGTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032528.2-1893s21c1
Sequence:CCGGATTTAGTGGTGGTCATGATAACTCGAGTTATCATGACCACCACTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032528.2-2170s21c1
Sequence:CCGGTCAAATTGAGGGACATCATTTCTCGAGAAATGATGTCCCTCAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1303s1c1
Sequence:CCGGCGCAAATCTTAACCTGTGGTACTCGAGTACCACAGGTTAAGATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1160s1c1
Sequence:CCGGCGTGGTTATGAGAAAGATGTTCTCGAGAACATCTTTCTCATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1199s1c1
Sequence:CCGGCGCATCATTAATTCGCAGATTCTCGAGAATCTGCGAATTAATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-476s1c1
Sequence:CCGGCAGTCCCAAGATGGGTTTGAACTCGAGTTCAAACCCATCTTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032528.1-1363s1c1
Sequence:CCGGGCATCGTCAGAGAAACCCAAACTCGAGTTTGGGTTTCTCTGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172829
ST6GAL2 MISSION shRNA Bacterial Glycerol Stock
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-810s1c1
Sequence:CCGGGCGTTACTACATGTCCTTCAACTCGAGTTGAAGGACATGTAGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1373s1c1
Sequence:CCGGCCAAGTTCATATGGCAGCTTTCTCGAGAAAGCTGCCATATGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-187s1c1
Sequence:CCGGCGAATGCTCTTTGGAATATTTCTCGAGAAATATTCCAAAGAGCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1130s1c1
Sequence:CCGGGCTATGAGAAAGATGTCGGAACTCGAGTTCCGACATCTTTCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1270s1c1
Sequence:CCGGGCCAATCTTAACCTGTGGTATCTCGAGATACCACAGGTTAAGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172829
ST6GAL2 MISSION shRNA shRNA Plasmid DNA
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-810s1c1
Sequence:CCGGGCGTTACTACATGTCCTTCAACTCGAGTTGAAGGACATGTAGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1373s1c1
Sequence:CCGGCCAAGTTCATATGGCAGCTTTCTCGAGAAAGCTGCCATATGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-187s1c1
Sequence:CCGGCGAATGCTCTTTGGAATATTTCTCGAGAAATATTCCAAAGAGCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1130s1c1
Sequence:CCGGGCTATGAGAAAGATGTCGGAACTCGAGTTCCGACATCTTTCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1270s1c1
Sequence:CCGGGCCAATCTTAACCTGTGGTATCTCGAGATACCACAGGTTAAGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172829
ST6GAL2 MISSION shRNA Lentiviral Transduction Particles
ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-810s1c1
Sequence:CCGGGCGTTACTACATGTCCTTCAACTCGAGTTGAAGGACATGTAGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1373s1c1
Sequence:CCGGCCAAGTTCATATGGCAGCTTTCTCGAGAAAGCTGCCATATGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-187s1c1
Sequence:CCGGCGAATGCTCTTTGGAATATTTCTCGAGAAATATTCCAAAGAGCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1130s1c1
Sequence:CCGGGCTATGAGAAAGATGTCGGAACTCGAGTTCCGACATCTTTCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172829.1-1270s1c1
Sequence:CCGGGCCAATCTTAACCTGTGGTATCTCGAGATACCACAGGTTAAGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks