EMAIL THIS PAGE TO A FRIEND

ST6GALNAC1

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1

Synonyms: HSY11339 SIAT7A ST6GalNAcI STYI
UniProtKB ID: Q9NSC7, Q6UW90, Q9NSC6
Gene ID:
Human(55808) Summary: Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]
Mouse(20445) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Rat(287920) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
chicken(396168) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
dog(100049002) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Horse(100058687) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
domestic cat(101085418) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
dog(483334) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
cow(618655) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
sheep(101116588) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
domestic guinea pig(100722416) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Domestic Rabbit(100357022) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
naked mole-rat(101716443) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018414 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133871 MISSION® esiRNA esiRNA human ST6GALNAC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018414 Rosetta Predictions human pricing
NM_001105859 Rosetta Predictions rat pricing
NM_011371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147612 predicted 1836
2 SASI_Hs01_00147613 predicted 914
3 SASI_Hs01_00147614 predicted 2022
4 SASI_Hs01_00147615 predicted 1335
5 SASI_Hs01_00147617 predicted 1090
6 SASI_Hs01_00147618 predicted 707
7 SASI_Hs01_00147619 predicted 835
8 SASI_Hs02_00351920 predicted 328
9 SASI_Hs01_00147620 predicted 972
10 SASI_Hs01_00147621 predicted 1545
11 SASI_Hs01_00147616 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213232 predicted 948
2 SASI_Rn02_00213233 predicted 1576
3 SASI_Rn02_00213234 predicted 1280
4 SASI_Rn02_00213235 predicted 855
5 SASI_Rn02_00213236 predicted 1481
6 SASI_Rn02_00213237 predicted 1188
7 SASI_Rn02_00213238 predicted 461
8 SASI_Rn02_00213239 predicted 1724
9 SASI_Rn02_00213240 predicted 214
10 SASI_Rn02_00213241 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083687 predicted 683
2 SASI_Mm01_00083688 predicted 1026
3 SASI_Mm02_00320544 predicted 1286
4 SASI_Mm02_00320545 predicted 1071
5 SASI_Mm02_00320546 predicted 212
6 SASI_Mm02_00320547 predicted 1478
7 SASI_Mm02_00320548 predicted 1358
8 SASI_Mm02_00320549 predicted 1233
9 SASI_Mm01_00083692 predicted 1187
10 SASI_Mm02_00320550 predicted 483
11 SASI_Mm01_00083686 predicted 482
12 SASI_Mm01_00083689 predicted 975
13 SASI_Mm01_00083690 predicted 242
14 SASI_Mm01_00083691 predicted 488
15 SASI_Mm01_00083693 predicted 1072
16 SASI_Mm01_00083694 predicted 419
17 SASI_Mm01_00083695 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018414
ST6GALNAC1 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1243s1c1
Sequence:CCGGGCTCTCATTAAAGGCTACGAACTCGAGTTCGTAGCCTTTAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1536s1c1
Sequence:CCGGCCCAGACTTTCTCCGATACATCTCGAGATGTATCGGAGAAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-939s1c1
Sequence:CCGGCCAGAAACTCTTTCTGCCCAACTCGAGTTGGGCAGAAAGAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-200s1c1
Sequence:CCGGGCACAGAGAACATTAAAGAAACTCGAGTTTCTTTAATGTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1431s1c1
Sequence:CCGGGCTTATGAATCAGACGGTGATCTCGAGATCACCGTCTGATTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018414.3-1394s21c1
Sequence:CCGGGGACATCCTTCTACGGCTTTACTCGAGTAAAGCCGTAGAAGGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018414.3-1013s21c1
Sequence:CCGGCTGACTCTGTGAAGATCAAAGCTCGAGCTTTGATCTTCACAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018414.3-2352s21c1
Sequence:CCGGGTGAAATCTTGAAGGTATTACCTCGAGGTAATACCTTCAAGATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018414
ST6GALNAC1 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1243s1c1
Sequence:CCGGGCTCTCATTAAAGGCTACGAACTCGAGTTCGTAGCCTTTAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1536s1c1
Sequence:CCGGCCCAGACTTTCTCCGATACATCTCGAGATGTATCGGAGAAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-939s1c1
Sequence:CCGGCCAGAAACTCTTTCTGCCCAACTCGAGTTGGGCAGAAAGAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-200s1c1
Sequence:CCGGGCACAGAGAACATTAAAGAAACTCGAGTTTCTTTAATGTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1431s1c1
Sequence:CCGGGCTTATGAATCAGACGGTGATCTCGAGATCACCGTCTGATTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018414.3-1394s21c1
Sequence:CCGGGGACATCCTTCTACGGCTTTACTCGAGTAAAGCCGTAGAAGGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018414.3-1013s21c1
Sequence:CCGGCTGACTCTGTGAAGATCAAAGCTCGAGCTTTGATCTTCACAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018414.3-2352s21c1
Sequence:CCGGGTGAAATCTTGAAGGTATTACCTCGAGGTAATACCTTCAAGATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018414
ST6GALNAC1 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1243s1c1
Sequence:CCGGGCTCTCATTAAAGGCTACGAACTCGAGTTCGTAGCCTTTAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1536s1c1
Sequence:CCGGCCCAGACTTTCTCCGATACATCTCGAGATGTATCGGAGAAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-939s1c1
Sequence:CCGGCCAGAAACTCTTTCTGCCCAACTCGAGTTGGGCAGAAAGAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-200s1c1
Sequence:CCGGGCACAGAGAACATTAAAGAAACTCGAGTTTCTTTAATGTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018414.2-1431s1c1
Sequence:CCGGGCTTATGAATCAGACGGTGATCTCGAGATCACCGTCTGATTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018414.3-1394s21c1
Sequence:CCGGGGACATCCTTCTACGGCTTTACTCGAGTAAAGCCGTAGAAGGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018414.3-1013s21c1
Sequence:CCGGCTGACTCTGTGAAGATCAAAGCTCGAGCTTTGATCTTCACAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018414.3-2352s21c1
Sequence:CCGGGTGAAATCTTGAAGGTATTACCTCGAGGTAATACCTTCAAGATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011371
ST6GALNAC1 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011371.1-1714s1c1
Sequence:CCGGCGACCACTTACAACACAGAATCTCGAGATTCTGTGTTGTAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1371s1c1
Sequence:CCGGCTTTCTCCGTTACATGAAGAACTCGAGTTCTTCATGTAACGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1072s1c1
Sequence:CCGGGCCGTTATTAAAGGATATGAACTCGAGTTCATATCCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1365s1c1
Sequence:CCGGCCCAGACTTTCTCCGTTACATCTCGAGATGTAACGGAGAAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-222s1c1
Sequence:CCGGGCGACAGTTCATACTGAACAACTCGAGTTGTTCAGTATGAACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011371.2-2054s21c1
Sequence:CCGGGGGTGAGTAGACTGAACACATCTCGAGATGTGTTCAGTCTACTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011371.2-2109s21c1
Sequence:CCGGGTGCCACTGAATGCTTGTAATCTCGAGATTACAAGCATTCAGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011371
ST6GALNAC1 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011371.1-1714s1c1
Sequence:CCGGCGACCACTTACAACACAGAATCTCGAGATTCTGTGTTGTAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1371s1c1
Sequence:CCGGCTTTCTCCGTTACATGAAGAACTCGAGTTCTTCATGTAACGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1072s1c1
Sequence:CCGGGCCGTTATTAAAGGATATGAACTCGAGTTCATATCCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1365s1c1
Sequence:CCGGCCCAGACTTTCTCCGTTACATCTCGAGATGTAACGGAGAAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-222s1c1
Sequence:CCGGGCGACAGTTCATACTGAACAACTCGAGTTGTTCAGTATGAACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011371.2-2054s21c1
Sequence:CCGGGGGTGAGTAGACTGAACACATCTCGAGATGTGTTCAGTCTACTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011371.2-2109s21c1
Sequence:CCGGGTGCCACTGAATGCTTGTAATCTCGAGATTACAAGCATTCAGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011371
ST6GALNAC1 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011371.1-1714s1c1
Sequence:CCGGCGACCACTTACAACACAGAATCTCGAGATTCTGTGTTGTAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1371s1c1
Sequence:CCGGCTTTCTCCGTTACATGAAGAACTCGAGTTCTTCATGTAACGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1072s1c1
Sequence:CCGGGCCGTTATTAAAGGATATGAACTCGAGTTCATATCCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-1365s1c1
Sequence:CCGGCCCAGACTTTCTCCGTTACATCTCGAGATGTAACGGAGAAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011371.1-222s1c1
Sequence:CCGGGCGACAGTTCATACTGAACAACTCGAGTTGTTCAGTATGAACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011371.2-2054s21c1
Sequence:CCGGGGGTGAGTAGACTGAACACATCTCGAGATGTGTTCAGTCTACTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011371.2-2109s21c1
Sequence:CCGGGTGCCACTGAATGCTTGTAATCTCGAGATTACAAGCATTCAGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks