EMAIL THIS PAGE TO A FRIEND

ST6GALNAC3

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3

Synonyms: PRO7177 SIAT7C ST6GALNACIII STY
UniProtKB ID: Q8NDV1, Q6PCE0, Q6UX29, Q8N259
Gene ID:
Human(256435) Summary: ST6GALNAC3 belongs to a family of sialyltransferases that transfer sialic acids from CMP-sialic acid to terminal positions of carbohydrate groups in glycoproteins and glycolipids (Lee et al., 1999 [PubMed 10207017]
Mouse(20447) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Rat(29758) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Zebrafish(322609) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
domestic cat(101091035) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
dog(490205) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
chicken(404746) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
cow(782689) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
sheep(101121471) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
domestic guinea pig(100714995) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
naked mole-rat(101708035) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
195 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152996 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152996 Rosetta Predictions human pricing
NM_019123 Rosetta Predictions rat pricing
NM_011372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178736 predicted 827
2 SASI_Hs01_00178737 predicted 318
3 SASI_Hs02_00366949 predicted 224
4 SASI_Hs01_00178739 predicted 712
5 SASI_Hs01_00178740 predicted 312
6 SASI_Hs01_00178741 predicted 436
7 SASI_Hs01_00178743 predicted 393
8 SASI_Hs02_00366950 predicted 237
9 SASI_Hs01_00178744 predicted 372
10 SASI_Hs02_00366951 predicted 246
11 SASI_Hs01_00178735 predicted 278
12 SASI_Hs01_00178738 predicted 292
13 SASI_Hs01_00178742 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066598 predicted 274
2 SASI_Rn01_00066599 predicted 1406
3 SASI_Rn01_00066600 predicted 395
4 SASI_Rn01_00066601 predicted 1014
5 SASI_Rn01_00066602 predicted 324
6 SASI_Rn01_00066603 predicted 1091
7 SASI_Rn01_00066604 predicted 1388
8 SASI_Rn01_00066605 predicted 1421
9 SASI_Rn01_00066607 predicted 908
10 SASI_Rn02_00261858 predicted 434
11 SASI_Rn01_00066606 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032793 predicted 840
2 SASI_Mm01_00032794 predicted 242
3 SASI_Mm01_00032795 predicted 419
4 SASI_Mm01_00032797 predicted 397
5 SASI_Mm01_00032798 predicted 359
6 SASI_Mm01_00032799 predicted 587
7 SASI_Mm01_00032800 predicted 308
8 SASI_Mm02_00320551 predicted 842
9 SASI_Mm01_00032801 predicted 505
10 SASI_Mm01_00032802 predicted 776
11 SASI_Mm01_00032796 predicted 830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011372
ST6GALNAC3 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011372.1-2504s1c1
Sequence:CCGGCCGTAGATCAATGGTCCTTAACTCGAGTTAAGGACCATTGATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-148s1c1
Sequence:CCGGGCCTTGTCAATGATGCGACTTCTCGAGAAGTCGCATCATTGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-939s1c1
Sequence:CCGGGCCAAGAAGCACAGAATAGTACTCGAGTACTATTCTGTGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-776s1c1
Sequence:CCGGCGGGATGATAAATGAAACCTACTCGAGTAGGTTTCATTTATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-317s1c1
Sequence:CCGGCGTGTCAAATTCAGGTCAAATCTCGAGATTTGACCTGAATTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-572s21c1
Sequence:CCGGCATCGTGTACAACATGTTAAACTCGAGTTTAACATGTTGTACACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-247s21c1
Sequence:CCGGGAACTCACTATGGATACATAACTCGAGTTATGTATCCATAGTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-848s21c1
Sequence:CCGGGAAAGATGAGTGTAACGAATACTCGAGTATTCGTTACACTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011372.2-1105s21c1
Sequence:CCGGTACTGACTCTGTTAGTAATTTCTCGAGAAATTACTAACAGAGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011372.2-1173s21c1
Sequence:CCGGGGTGGTTCGGCCCTATCAATTCTCGAGAATTGATAGGGCCGAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011372
ST6GALNAC3 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011372.1-2504s1c1
Sequence:CCGGCCGTAGATCAATGGTCCTTAACTCGAGTTAAGGACCATTGATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-148s1c1
Sequence:CCGGGCCTTGTCAATGATGCGACTTCTCGAGAAGTCGCATCATTGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-939s1c1
Sequence:CCGGGCCAAGAAGCACAGAATAGTACTCGAGTACTATTCTGTGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-776s1c1
Sequence:CCGGCGGGATGATAAATGAAACCTACTCGAGTAGGTTTCATTTATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-317s1c1
Sequence:CCGGCGTGTCAAATTCAGGTCAAATCTCGAGATTTGACCTGAATTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-572s21c1
Sequence:CCGGCATCGTGTACAACATGTTAAACTCGAGTTTAACATGTTGTACACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-247s21c1
Sequence:CCGGGAACTCACTATGGATACATAACTCGAGTTATGTATCCATAGTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-848s21c1
Sequence:CCGGGAAAGATGAGTGTAACGAATACTCGAGTATTCGTTACACTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011372.2-1105s21c1
Sequence:CCGGTACTGACTCTGTTAGTAATTTCTCGAGAAATTACTAACAGAGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011372.2-1173s21c1
Sequence:CCGGGGTGGTTCGGCCCTATCAATTCTCGAGAATTGATAGGGCCGAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011372
ST6GALNAC3 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011372.1-2504s1c1
Sequence:CCGGCCGTAGATCAATGGTCCTTAACTCGAGTTAAGGACCATTGATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-148s1c1
Sequence:CCGGGCCTTGTCAATGATGCGACTTCTCGAGAAGTCGCATCATTGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-939s1c1
Sequence:CCGGGCCAAGAAGCACAGAATAGTACTCGAGTACTATTCTGTGCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-776s1c1
Sequence:CCGGCGGGATGATAAATGAAACCTACTCGAGTAGGTTTCATTTATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011372.1-317s1c1
Sequence:CCGGCGTGTCAAATTCAGGTCAAATCTCGAGATTTGACCTGAATTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-572s21c1
Sequence:CCGGCATCGTGTACAACATGTTAAACTCGAGTTTAACATGTTGTACACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-247s21c1
Sequence:CCGGGAACTCACTATGGATACATAACTCGAGTTATGTATCCATAGTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011372.2-848s21c1
Sequence:CCGGGAAAGATGAGTGTAACGAATACTCGAGTATTCGTTACACTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011372.2-1105s21c1
Sequence:CCGGTACTGACTCTGTTAGTAATTTCTCGAGAAATTACTAACAGAGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011372.2-1173s21c1
Sequence:CCGGGGTGGTTCGGCCCTATCAATTCTCGAGAATTGATAGGGCCGAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152996
ST6GALNAC3 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-223s1c1
Sequence:CCGGGCGTCTTGTAAATGAAGTGAACTCGAGTTCACTTCATTTACAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-876s1c1
Sequence:CCGGGCAAGACAGAAGGGTATAGAACTCGAGTTCTATACCCTTCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-1003s1c1
Sequence:CCGGGTTTGCTAAATGGGCCAAGAACTCGAGTTCTTGGCCCATTTAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-324s1c1
Sequence:CCGGGAACTCACTATGGATACATAACTCGAGTTATGTATCCATAGTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-189s1c1
Sequence:CCGGGCTTCATAGCAGCGTTCCTTTCTCGAGAAAGGAACGCTGCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152996.2-1221s21c1
Sequence:CCGGGATGGTGACTCTGCTAGTAATCTCGAGATTACTAGCAGAGTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152996.2-1094s21c1
Sequence:CCGGTGATCTTGCCGCATCACTTAACTCGAGTTAAGTGATGCGGCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152996
ST6GALNAC3 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-223s1c1
Sequence:CCGGGCGTCTTGTAAATGAAGTGAACTCGAGTTCACTTCATTTACAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-876s1c1
Sequence:CCGGGCAAGACAGAAGGGTATAGAACTCGAGTTCTATACCCTTCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-1003s1c1
Sequence:CCGGGTTTGCTAAATGGGCCAAGAACTCGAGTTCTTGGCCCATTTAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-324s1c1
Sequence:CCGGGAACTCACTATGGATACATAACTCGAGTTATGTATCCATAGTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-189s1c1
Sequence:CCGGGCTTCATAGCAGCGTTCCTTTCTCGAGAAAGGAACGCTGCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152996.2-1221s21c1
Sequence:CCGGGATGGTGACTCTGCTAGTAATCTCGAGATTACTAGCAGAGTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152996.2-1094s21c1
Sequence:CCGGTGATCTTGCCGCATCACTTAACTCGAGTTAAGTGATGCGGCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152996
ST6GALNAC3 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-223s1c1
Sequence:CCGGGCGTCTTGTAAATGAAGTGAACTCGAGTTCACTTCATTTACAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-876s1c1
Sequence:CCGGGCAAGACAGAAGGGTATAGAACTCGAGTTCTATACCCTTCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-1003s1c1
Sequence:CCGGGTTTGCTAAATGGGCCAAGAACTCGAGTTCTTGGCCCATTTAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-324s1c1
Sequence:CCGGGAACTCACTATGGATACATAACTCGAGTTATGTATCCATAGTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152996.1-189s1c1
Sequence:CCGGGCTTCATAGCAGCGTTCCTTTCTCGAGAAAGGAACGCTGCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152996.2-1221s21c1
Sequence:CCGGGATGGTGACTCTGCTAGTAATCTCGAGATTACTAGCAGAGTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152996.2-1094s21c1
Sequence:CCGGTGATCTTGCCGCATCACTTAACTCGAGTTAAGTGATGCGGCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks