EMAIL THIS PAGE TO A FRIEND

ST6GALNAC4

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4

Synonyms: IV SIAT3-C SIAT3C SIAT7-D SIAT7D ST6GALNACIV ST6GalNAc
Gene ID:
Human(27090) Summary: The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein prefers glycoproteins rather than glycolipids as substrates and shows restricted substrate specificity, utilizing only the trisaccharide sequence Neu5Ac-alpha-2,3-Gal-beta-1,3-GalNAc. In addition, it is involved in the synthesis of ganglioside GD1A from GM1B. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20448) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Rat(407764) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
naked mole-rat(101717187) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
domestic guinea pig(100725743) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
cow(404124) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
sheep(101123019) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Zebrafish(751653) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
chicken(395182) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
domestic cat(101094459) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
dog(609133) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175039 Rosetta Predictions human pricing
NM_175040 Rosetta Predictions human pricing
XM_001080040 Rosetta Predictions rat pricing
NM_011373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172224 predicted 1345
2 SASI_Hs01_00172226 predicted 902
3 SASI_Hs02_00368935 predicted 562
4 SASI_Hs01_00172229 predicted 968
5 SASI_Hs02_00368936 predicted 671
6 SASI_Hs01_00172223 predicted 1402
7 SASI_Hs01_00172225 predicted 941
8 SASI_Hs01_00172227 predicted 1033
9 SASI_Hs01_00172228 predicted 1053
10 SASI_Hs02_00368937 predicted 1128
11 SASI_Hs01_00172230 predicted 1213
12 SASI_Hs01_00172231 predicted 1234
13 SASI_Hs01_00172232 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172402 predicted 1255
2 SASI_Hs01_00172404 predicted 816
3 SASI_Hs02_00368938 predicted 481
4 SASI_Hs01_00172407 predicted 874
5 SASI_Hs02_00368939 predicted 583
6 SASI_Hs01_00172401 predicted 1316
7 SASI_Hs01_00172403 predicted 857
8 SASI_Hs01_00172405 predicted 953
9 SASI_Hs01_00172406 predicted 966
10 SASI_Hs02_00368940 predicted 1047
11 SASI_Hs01_00172408 predicted 1131
12 SASI_Hs01_00172409 predicted 1155
13 SASI_Hs01_00172410 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366349 predicted 1430
2 SASI_Rn02_00366350 predicted 1440
3 SASI_Rn02_00366351 predicted 1652
4 SASI_Rn02_00366352 predicted 373
5 SASI_Rn02_00366353 predicted 1655
6 SASI_Rn02_00366354 predicted 376
7 SASI_Rn02_00366355 predicted 1501
8 SASI_Rn02_00366356 predicted 860
9 SASI_Rn02_00366357 predicted 865
10 SASI_Rn02_00366358 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083255 predicted 1193
2 SASI_Mm01_00083256 predicted 1393
3 SASI_Mm01_00083257 predicted 566
4 SASI_Mm01_00083258 predicted 792
5 SASI_Mm01_00083259 predicted 1151
6 SASI_Mm01_00083260 predicted 876
7 SASI_Mm01_00083261 predicted 374
8 SASI_Mm01_00083262 predicted 1394
9 SASI_Mm01_00083263 predicted 1161
10 SASI_Mm01_00083264 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011373
VALIDATED
ST6GALNAC4 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-579s21c1
Sequence:CCGGGCGCAACTACTCACACTATTTCTCGAGAAATAGTGTGAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-789s21c1
Sequence:CCGGCCGGAGACAATCAGGCTCCTTCTCGAGAAGGAGCCTGATTGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-948s21c1
Sequence:CCGGGCTAGATGAGTGTCAGATGTACTCGAGTACATCTGACACTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011373.2-1268s21c1
Sequence:CCGGAGTCGAGAAGATGCCATTTACCTCGAGGTAAATGGCATCTTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-1490s1c1
Sequence:CCGGCCCTGGAACTTGGGATTTGATCTCGAGATCAAATCCCAAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-789s1c1
Sequence:CCGGCCGGAGACAATCAGGCTCCTTCTCGAGAAGGAGCCTGATTGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-723s1c1
Sequence:CCGGGTACACCTTCACTGAACGCATCTCGAGATGCGTTCAGTGAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-579s1c1
Sequence:CCGGGCGCAACTACTCACACTATTTCTCGAGAAATAGTGTGAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-948s1c1
Sequence:CCGGGCTAGATGAGTGTCAGATGTACTCGAGTACATCTGACACTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011373
VALIDATED
ST6GALNAC4 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-579s21c1
Sequence:CCGGGCGCAACTACTCACACTATTTCTCGAGAAATAGTGTGAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-789s21c1
Sequence:CCGGCCGGAGACAATCAGGCTCCTTCTCGAGAAGGAGCCTGATTGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-948s21c1
Sequence:CCGGGCTAGATGAGTGTCAGATGTACTCGAGTACATCTGACACTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011373.2-1268s21c1
Sequence:CCGGAGTCGAGAAGATGCCATTTACCTCGAGGTAAATGGCATCTTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-1490s1c1
Sequence:CCGGCCCTGGAACTTGGGATTTGATCTCGAGATCAAATCCCAAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-789s1c1
Sequence:CCGGCCGGAGACAATCAGGCTCCTTCTCGAGAAGGAGCCTGATTGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-723s1c1
Sequence:CCGGGTACACCTTCACTGAACGCATCTCGAGATGCGTTCAGTGAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-579s1c1
Sequence:CCGGGCGCAACTACTCACACTATTTCTCGAGAAATAGTGTGAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-948s1c1
Sequence:CCGGGCTAGATGAGTGTCAGATGTACTCGAGTACATCTGACACTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011373
VALIDATED
ST6GALNAC4 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-579s21c1
Sequence:CCGGGCGCAACTACTCACACTATTTCTCGAGAAATAGTGTGAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-789s21c1
Sequence:CCGGCCGGAGACAATCAGGCTCCTTCTCGAGAAGGAGCCTGATTGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011373.2-948s21c1
Sequence:CCGGGCTAGATGAGTGTCAGATGTACTCGAGTACATCTGACACTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011373.2-1268s21c1
Sequence:CCGGAGTCGAGAAGATGCCATTTACCTCGAGGTAAATGGCATCTTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-1490s1c1
Sequence:CCGGCCCTGGAACTTGGGATTTGATCTCGAGATCAAATCCCAAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-789s1c1
Sequence:CCGGCCGGAGACAATCAGGCTCCTTCTCGAGAAGGAGCCTGATTGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-723s1c1
Sequence:CCGGGTACACCTTCACTGAACGCATCTCGAGATGCGTTCAGTGAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-579s1c1
Sequence:CCGGGCGCAACTACTCACACTATTTCTCGAGAAATAGTGTGAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011373.2-948s1c1
Sequence:CCGGGCTAGATGAGTGTCAGATGTACTCGAGTACATCTGACACTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014403
ST6GALNAC4 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014403.3-1362s1c1
Sequence:CCGGCCTGAGTAATTCATGGCATTTCTCGAGAAATGCCATGAATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-671s1c1
Sequence:CCGGGCGCAACTATTCACACTACTTCTCGAGAAGTAGTGTGAATAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-314s1c1
Sequence:CCGGCGTGGTCTTCTCTGCCGTCTACTCGAGTAGACGGCAGAGAAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-1013s1c1
Sequence:CCGGGCCTTACCACTACTTTGAGAACTCGAGTTCTCAAAGTAGTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-430s1c1
Sequence:CCGGCCCTGCACTTCAGTGGATATACTCGAGTATATCCACTGAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014403
ST6GALNAC4 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014403.3-1362s1c1
Sequence:CCGGCCTGAGTAATTCATGGCATTTCTCGAGAAATGCCATGAATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-671s1c1
Sequence:CCGGGCGCAACTATTCACACTACTTCTCGAGAAGTAGTGTGAATAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-314s1c1
Sequence:CCGGCGTGGTCTTCTCTGCCGTCTACTCGAGTAGACGGCAGAGAAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-1013s1c1
Sequence:CCGGGCCTTACCACTACTTTGAGAACTCGAGTTCTCAAAGTAGTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-430s1c1
Sequence:CCGGCCCTGCACTTCAGTGGATATACTCGAGTATATCCACTGAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014403
ST6GALNAC4 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014403.3-1362s1c1
Sequence:CCGGCCTGAGTAATTCATGGCATTTCTCGAGAAATGCCATGAATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-671s1c1
Sequence:CCGGGCGCAACTATTCACACTACTTCTCGAGAAGTAGTGTGAATAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-314s1c1
Sequence:CCGGCGTGGTCTTCTCTGCCGTCTACTCGAGTAGACGGCAGAGAAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-1013s1c1
Sequence:CCGGGCCTTACCACTACTTTGAGAACTCGAGTTCTCAAAGTAGTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014403.3-430s1c1
Sequence:CCGGCCCTGCACTTCAGTGGATATACTCGAGTATATCCACTGAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks