EMAIL THIS PAGE TO A FRIEND

ST6GALNAC5

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5

Synonyms: SIAT7E ST6GalNAcV
UniProtKB ID: Q9BVH7, B1AK82
Gene ID:
Human(81849) Summary: ST6GALNAC5 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]
Mouse(26938) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Rat(365984) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
chicken(407778) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Horse(100066822) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
domestic cat(101091546) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
dog(613015) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
cow(540995) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
sheep(101108622) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
domestic guinea pig(100715749) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
naked mole-rat(101707663) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007471 MISSION® esiRNA esiRNA targeting human ST6GALNAC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030965 Rosetta Predictions human pricing
XM_001078153 Rosetta Predictions rat pricing
XM_345318 Rosetta Predictions rat pricing
NM_012028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102156 predicted 993
2 SASI_Hs01_00102157 predicted 953
3 SASI_Hs01_00102158 predicted 872
4 SASI_Hs01_00102159 predicted 908
5 SASI_Hs01_00102161 predicted 1061
6 SASI_Hs01_00102162 predicted 528
7 SASI_Hs01_00102163 predicted 1048
8 SASI_Hs01_00102164 predicted 997
9 SASI_Hs02_00358553 predicted 724
10 SASI_Hs02_00358554 predicted 1015
11 SASI_Hs01_00102155 predicted 797
12 SASI_Hs01_00102160 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359819 predicted 1483
2 SASI_Rn02_00359820 predicted 1376
3 SASI_Rn02_00359821 predicted 1627
4 SASI_Rn02_00359822 predicted 585
5 SASI_Rn02_00359823 predicted 1473
6 SASI_Rn02_00359824 predicted 1312
7 SASI_Rn02_00359825 predicted 1135
8 SASI_Rn02_00359826 predicted 1406
9 SASI_Rn02_00359827 predicted 585
10 SASI_Rn02_00359828 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398214 predicted 264
2 SASI_Rn02_00398215 predicted 256
3 SASI_Rn02_00398216 predicted 255
4 SASI_Rn02_00398217 predicted 259
5 SASI_Rn02_00398218 predicted 230
6 SASI_Rn02_00398219 predicted 267
7 SASI_Rn02_00398220 predicted 311
8 SASI_Rn02_00398221 predicted 299
9 SASI_Rn02_00398222 predicted 320
10 SASI_Rn02_00398223 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089386 predicted 1547
2 SASI_Mm01_00089387 predicted 1269
3 SASI_Mm01_00089388 predicted 1450
4 SASI_Mm01_00089389 predicted 1248
5 SASI_Mm01_00089390 predicted 1602
6 SASI_Mm01_00089391 predicted 1112
7 SASI_Mm01_00089392 predicted 1390
8 SASI_Mm01_00089393 predicted 1055
9 SASI_Mm01_00089394 predicted 1366
10 SASI_Mm01_00089395 predicted 1335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012028
ST6GALNAC5 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012028.2-1742s1c1
Sequence:CCGGCCTGACTCTTTAATCCTGAATCTCGAGATTCAGGATTAAAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-1116s1c1
Sequence:CCGGCGGACATTCAACATTCACTTTCTCGAGAAAGTGAATGTTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-994s1c1
Sequence:CCGGCCTATCATTACTATGAGCCTTCTCGAGAAGGCTCATAGTAATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-543s1c1
Sequence:CCGGGAGTGTGTTATCCGCATGAATCTCGAGATTCATGCGGATAACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-1073s1c1
Sequence:CCGGTCACCGTTTCATTACAGAGAACTCGAGTTCTCTGTAATGAAACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012028
ST6GALNAC5 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012028.2-1742s1c1
Sequence:CCGGCCTGACTCTTTAATCCTGAATCTCGAGATTCAGGATTAAAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-1116s1c1
Sequence:CCGGCGGACATTCAACATTCACTTTCTCGAGAAAGTGAATGTTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-994s1c1
Sequence:CCGGCCTATCATTACTATGAGCCTTCTCGAGAAGGCTCATAGTAATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-543s1c1
Sequence:CCGGGAGTGTGTTATCCGCATGAATCTCGAGATTCATGCGGATAACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-1073s1c1
Sequence:CCGGTCACCGTTTCATTACAGAGAACTCGAGTTCTCTGTAATGAAACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012028
ST6GALNAC5 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012028.2-1742s1c1
Sequence:CCGGCCTGACTCTTTAATCCTGAATCTCGAGATTCAGGATTAAAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-1116s1c1
Sequence:CCGGCGGACATTCAACATTCACTTTCTCGAGAAAGTGAATGTTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-994s1c1
Sequence:CCGGCCTATCATTACTATGAGCCTTCTCGAGAAGGCTCATAGTAATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-543s1c1
Sequence:CCGGGAGTGTGTTATCCGCATGAATCTCGAGATTCATGCGGATAACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012028.2-1073s1c1
Sequence:CCGGTCACCGTTTCATTACAGAGAACTCGAGTTCTCTGTAATGAAACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030965
ST6GALNAC5 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-527s1c1
Sequence:CCGGGAGTGTGTCATCCGCATGAATCTCGAGATTCATGCGGATGACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-1135s1c1
Sequence:CCGGGAAACCAGAATCACTTGCTATCTCGAGATAGCAAGTGATTCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-874s1c1
Sequence:CCGGTGGCTGGTTTACAATGACAATCTCGAGATTGTCATTGTAAACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-1100s1c1
Sequence:CCGGCGGACATTCAATATTCACTTTCTCGAGAAAGTGAATATTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030965.1-1049s21c1
Sequence:CCGGGGCAGTCATCACCGCTTTATCCTCGAGGATAAAGCGGTGATGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030965.1-1482s21c1
Sequence:CCGGGCCTTTGAAACTGCAACATAACTCGAGTTATGTTGCAGTTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030965
ST6GALNAC5 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-527s1c1
Sequence:CCGGGAGTGTGTCATCCGCATGAATCTCGAGATTCATGCGGATGACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-1135s1c1
Sequence:CCGGGAAACCAGAATCACTTGCTATCTCGAGATAGCAAGTGATTCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-874s1c1
Sequence:CCGGTGGCTGGTTTACAATGACAATCTCGAGATTGTCATTGTAAACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-1100s1c1
Sequence:CCGGCGGACATTCAATATTCACTTTCTCGAGAAAGTGAATATTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030965.1-1049s21c1
Sequence:CCGGGGCAGTCATCACCGCTTTATCCTCGAGGATAAAGCGGTGATGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030965.1-1482s21c1
Sequence:CCGGGCCTTTGAAACTGCAACATAACTCGAGTTATGTTGCAGTTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030965
ST6GALNAC5 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-527s1c1
Sequence:CCGGGAGTGTGTCATCCGCATGAATCTCGAGATTCATGCGGATGACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-1135s1c1
Sequence:CCGGGAAACCAGAATCACTTGCTATCTCGAGATAGCAAGTGATTCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-874s1c1
Sequence:CCGGTGGCTGGTTTACAATGACAATCTCGAGATTGTCATTGTAAACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030965.1-1100s1c1
Sequence:CCGGCGGACATTCAATATTCACTTTCTCGAGAAAGTGAATATTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030965.1-1049s21c1
Sequence:CCGGGGCAGTCATCACCGCTTTATCCTCGAGGATAAAGCGGTGATGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030965.1-1482s21c1
Sequence:CCGGGCCTTTGAAACTGCAACATAACTCGAGTTATGTTGCAGTTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks