EMAIL THIS PAGE TO A FRIEND

ST6GALNAC6

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6

Synonyms: RP11-203J24.3 SIAT7F ST6GALNACVI
UniProtKB ID: Q969X2, B3KQ01, Q5T9C4, Q5T9C5, Q9H8A2, Q9ULB8
Gene ID:
Human(30815) Summary: ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]
Mouse(50935) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Rat(407765) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Zebrafish(407715) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Horse(100070405) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
domestic cat(101094218) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
dog(491324) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
chicken(425243) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
naked mole-rat(101717761) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
domestic guinea pig(100724575) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
cow(407222) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
sheep(101123278) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003541 MISSION® esiRNA esiRNA targeting human ST6GALNAC6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013443 Rosetta Predictions human pricing
NM_001015036 Rosetta Predictions rat pricing
NM_001025310 Rosetta Predictions mouse pricing
NM_001025311 Rosetta Predictions mouse pricing
NM_016973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158504 predicted 990
2 SASI_Hs01_00158505 predicted 805
3 SASI_Hs01_00158506 predicted 1292
4 SASI_Hs01_00158507 predicted 1243
5 SASI_Hs02_00344848 predicted 370
6 SASI_Hs01_00158508 predicted 1292
7 SASI_Hs01_00158509 predicted 497
8 SASI_Hs01_00158510 predicted 1342
9 SASI_Hs01_00158512 predicted 501
10 SASI_Hs02_00344849 predicted 1532
11 SASI_Hs01_00158511 predicted 1422
12 SASI_Hs01_00158513 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044688 predicted 1438
2 SASI_Rn01_00044689 predicted 771
3 SASI_Rn01_00044690 predicted 1351
4 SASI_Rn01_00044691 predicted 1102
5 SASI_Rn01_00044693 predicted 1189
6 SASI_Rn01_00044694 predicted 464
7 SASI_Rn01_00044695 predicted 1257
8 SASI_Rn01_00044696 predicted 1290
9 SASI_Rn01_00044697 predicted 1119
10 SASI_Rn02_00202190 predicted 1100
11 SASI_Rn01_00044692 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026175 predicted 872
2 SASI_Mm01_00026176 predicted 955
3 SASI_Mm01_00026177 predicted 1594
4 SASI_Mm01_00026178 predicted 1495
5 SASI_Mm01_00026179 predicted 859
6 SASI_Mm01_00026180 predicted 545
7 SASI_Mm01_00026181 predicted 1011
8 SASI_Mm01_00026182 predicted 493
9 SASI_Mm01_00026183 predicted 1018
10 SASI_Mm01_00026184 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170123 predicted 763
2 SASI_Mm01_00170124 predicted 837
3 SASI_Mm01_00170125 predicted 1482
4 SASI_Mm01_00170126 predicted 1382
5 SASI_Mm01_00170127 predicted 747
6 SASI_Mm01_00170128 predicted 435
7 SASI_Mm01_00170129 predicted 903
8 SASI_Mm01_00170130 predicted 375
9 SASI_Mm01_00170131 predicted 908
10 SASI_Mm01_00170132 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058900 predicted 933
2 SASI_Mm01_00058901 predicted 1013
3 SASI_Mm01_00058902 predicted 1648
4 SASI_Mm01_00058903 predicted 1554
5 SASI_Mm01_00058904 predicted 920
6 SASI_Mm01_00058905 predicted 596
7 SASI_Mm01_00058906 predicted 1073
8 SASI_Mm01_00058907 predicted 547
9 SASI_Mm01_00058908 predicted 1079
10 SASI_Mm01_00058909 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013443
VALIDATED
ST6GALNAC6 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-841s21c1
Sequence:CCGGGGTTGAGCACAGGCTGGTTTACTCGAGTAAACCAGCCTGTGCTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-309s21c1
Sequence:CCGGGCCAATGAGGTCTTCCATTACCTCGAGGTAATGGAAGACCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-375s21c1
Sequence:CCGGTGGAGCATCACTGACGGCTATCTCGAGATAGCCGTCAGTGATGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-249s1c1
Sequence:CCGGGCAGTGTTCGTGATCCTCTTTCTCGAGAAAGAGGATCACGAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-779s1c1
Sequence:CCGGGCGGCAATTTGACGACCTCTTCTCGAGAAGAGGTCGTCAAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-353s1c1
Sequence:CCGGCCGACCTGTCAACCTCAAGAACTCGAGTTCTTGAGGTTGACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-507s1c1
Sequence:CCGGGAGTGTACAATCCGCATGAATCTCGAGATTCATGCGGATTGTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-983s1c1
Sequence:CCGGGCCGGACGAATGTGTCACCTACTCGAGTAGGTGACACATTCGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013443
VALIDATED
ST6GALNAC6 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-841s21c1
Sequence:CCGGGGTTGAGCACAGGCTGGTTTACTCGAGTAAACCAGCCTGTGCTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-309s21c1
Sequence:CCGGGCCAATGAGGTCTTCCATTACCTCGAGGTAATGGAAGACCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-375s21c1
Sequence:CCGGTGGAGCATCACTGACGGCTATCTCGAGATAGCCGTCAGTGATGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-249s1c1
Sequence:CCGGGCAGTGTTCGTGATCCTCTTTCTCGAGAAAGAGGATCACGAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-779s1c1
Sequence:CCGGGCGGCAATTTGACGACCTCTTCTCGAGAAGAGGTCGTCAAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-353s1c1
Sequence:CCGGCCGACCTGTCAACCTCAAGAACTCGAGTTCTTGAGGTTGACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-507s1c1
Sequence:CCGGGAGTGTACAATCCGCATGAATCTCGAGATTCATGCGGATTGTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-983s1c1
Sequence:CCGGGCCGGACGAATGTGTCACCTACTCGAGTAGGTGACACATTCGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013443
VALIDATED
ST6GALNAC6 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-841s21c1
Sequence:CCGGGGTTGAGCACAGGCTGGTTTACTCGAGTAAACCAGCCTGTGCTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-309s21c1
Sequence:CCGGGCCAATGAGGTCTTCCATTACCTCGAGGTAATGGAAGACCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013443.3-375s21c1
Sequence:CCGGTGGAGCATCACTGACGGCTATCTCGAGATAGCCGTCAGTGATGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-249s1c1
Sequence:CCGGGCAGTGTTCGTGATCCTCTTTCTCGAGAAAGAGGATCACGAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-779s1c1
Sequence:CCGGGCGGCAATTTGACGACCTCTTCTCGAGAAGAGGTCGTCAAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-353s1c1
Sequence:CCGGCCGACCTGTCAACCTCAAGAACTCGAGTTCTTGAGGTTGACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-507s1c1
Sequence:CCGGGAGTGTACAATCCGCATGAATCTCGAGATTCATGCGGATTGTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013443.3-983s1c1
Sequence:CCGGGCCGGACGAATGTGTCACCTACTCGAGTAGGTGACACATTCGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025310
VALIDATED
ST6GALNAC6 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-957s21c1
Sequence:CCGGCGCATGCCATACCACTACTATCTCGAGATAGTAGTGGTATGGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025310.1-2179s21c1
Sequence:CCGGCCCTTGCTTAAGCACTTTATTCTCGAGAATAAAGTGCTTAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-1085s21c1
Sequence:CCGGCCAACTCTACGGTATCACCTTCTCGAGAAGGTGATACCGTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-255s21c1
Sequence:CCGGGCAGTGTTTGTGATCCTCTTTCTCGAGAAAGAGGATCACAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-2179s1c1
Sequence:CCGGCCCTTGCTTAAGCACTTTATTCTCGAGAATAAAGTGCTTAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-255s1c1
Sequence:CCGGGCAGTGTTTGTGATCCTCTTTCTCGAGAAAGAGGATCACAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-368s1c1
Sequence:CCGGCAACCTCAAGAAGTGGAGTTTCTCGAGAAACTCCACTTCTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-1085s1c1
Sequence:CCGGCCAACTCTACGGTATCACCTTCTCGAGAAGGTGATACCGTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-957s1c1
Sequence:CCGGCGCATGCCATACCACTACTATCTCGAGATAGTAGTGGTATGGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025310
VALIDATED
ST6GALNAC6 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-957s21c1
Sequence:CCGGCGCATGCCATACCACTACTATCTCGAGATAGTAGTGGTATGGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025310.1-2179s21c1
Sequence:CCGGCCCTTGCTTAAGCACTTTATTCTCGAGAATAAAGTGCTTAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-1085s21c1
Sequence:CCGGCCAACTCTACGGTATCACCTTCTCGAGAAGGTGATACCGTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-255s21c1
Sequence:CCGGGCAGTGTTTGTGATCCTCTTTCTCGAGAAAGAGGATCACAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-2179s1c1
Sequence:CCGGCCCTTGCTTAAGCACTTTATTCTCGAGAATAAAGTGCTTAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-255s1c1
Sequence:CCGGGCAGTGTTTGTGATCCTCTTTCTCGAGAAAGAGGATCACAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-368s1c1
Sequence:CCGGCAACCTCAAGAAGTGGAGTTTCTCGAGAAACTCCACTTCTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-1085s1c1
Sequence:CCGGCCAACTCTACGGTATCACCTTCTCGAGAAGGTGATACCGTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-957s1c1
Sequence:CCGGCGCATGCCATACCACTACTATCTCGAGATAGTAGTGGTATGGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025310
VALIDATED
ST6GALNAC6 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-957s21c1
Sequence:CCGGCGCATGCCATACCACTACTATCTCGAGATAGTAGTGGTATGGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025310.1-2179s21c1
Sequence:CCGGCCCTTGCTTAAGCACTTTATTCTCGAGAATAAAGTGCTTAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-1085s21c1
Sequence:CCGGCCAACTCTACGGTATCACCTTCTCGAGAAGGTGATACCGTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025310.1-255s21c1
Sequence:CCGGGCAGTGTTTGTGATCCTCTTTCTCGAGAAAGAGGATCACAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-2179s1c1
Sequence:CCGGCCCTTGCTTAAGCACTTTATTCTCGAGAATAAAGTGCTTAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-255s1c1
Sequence:CCGGGCAGTGTTTGTGATCCTCTTTCTCGAGAAAGAGGATCACAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-368s1c1
Sequence:CCGGCAACCTCAAGAAGTGGAGTTTCTCGAGAAACTCCACTTCTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-1085s1c1
Sequence:CCGGCCAACTCTACGGTATCACCTTCTCGAGAAGGTGATACCGTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_001025310.1-957s1c1
Sequence:CCGGCGCATGCCATACCACTACTATCTCGAGATAGTAGTGGTATGGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks