EMAIL THIS PAGE TO A FRIEND

ST7

suppression of tumorigenicity 7

Synonyms: ETS7q FAM4A FAM4A1 HELG RAY1 SEN4 TSG7
Gene ID:
Human(7982) Summary: The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Mouse(64213) suppression of tumorigenicity 7
Rat(296911) suppression of tumorigenicity 7
cow(280933) suppression of tumorigenicity 7
sheep(100126576) suppression of tumorigenicity 7
domestic guinea pig(100135644) suppression of tumorigenicity 7
domestic guinea pig(100732407) suppression of tumorigenicity 7
naked mole-rat(101724284) suppression of tumorigenicity 7
Domestic Rabbit(100126567) suppression of tumorigenicity 7
Zebrafish(678587) suppression of tumorigenicity 7
Horse(100056055) suppression of tumorigenicity 7
domestic cat(493671) suppression of tumorigenicity 7
dog(475295) suppression of tumorigenicity 7
chicken(417770) suppression of tumorigenicity 7
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018412 siRNAs that have been validated in the lab human pricing
NM_021908 siRNAs that have been validated in the lab human pricing
NM_001004102 Rosetta Predictions rat pricing
XM_579127 Rosetta Predictions rat pricing
NM_001083315 Rosetta Predictions mouse pricing
NM_022332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018412 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056320 validated 1290
2 SASI_Hs01_00056319 predicted 1216
3 SASI_Hs01_00056321 predicted 607
4 SASI_Hs01_00056322 predicted 1456
5 SASI_Hs01_00056323 predicted 1183
6 SASI_Hs01_00056324 predicted 418
7 SASI_Hs01_00056325 predicted 1096
8 SASI_Hs01_00056326 predicted 1290
9 SASI_Hs01_00056327 predicted 1472
10 SASI_Hs01_00056328 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021908 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168531 validated 1355
2 SASI_Hs01_00168530 predicted 1282
3 SASI_Hs01_00168532 predicted 608
4 SASI_Hs01_00168533 predicted 1532
5 SASI_Hs01_00168534 predicted 1255
6 SASI_Hs01_00168535 predicted 417
7 SASI_Hs01_00168536 predicted 1170
8 SASI_Hs01_00168537 predicted 1359
9 SASI_Hs01_00168538 predicted 1538
10 SASI_Hs01_00168539 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082005 predicted 1476
2 SASI_Rn02_00198155 predicted 541
3 SASI_Rn01_00082006 predicted 1714
4 SASI_Rn01_00082007 predicted 1621
5 SASI_Rn01_00082008 predicted 1424
6 SASI_Rn01_00082010 predicted 441
7 SASI_Rn01_00082011 predicted 1428
8 SASI_Rn01_00082012 predicted 382
9 SASI_Rn01_00082013 predicted 1697
10 SASI_Rn01_00082014 predicted 1185
11 SASI_Rn01_00082009 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183483 predicted 858
2 SASI_Rn01_00183484 predicted 541
3 SASI_Rn01_00183485 predicted 953
4 SASI_Rn01_00183486 predicted 1248
5 SASI_Rn01_00183487 predicted 576
6 SASI_Rn01_00183488 predicted 445
7 SASI_Rn01_00183489 predicted 1188
8 SASI_Rn01_00183490 predicted 796
9 SASI_Rn01_00183491 predicted 1190
10 SASI_Rn01_00183492 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299571 predicted 1541
2 SASI_Mm02_00299572 predicted 1787
3 SASI_Mm02_00299573 predicted 1117
4 SASI_Mm02_00299574 predicted 1452
5 SASI_Mm02_00299575 predicted 1694
6 SASI_Mm02_00299576 predicted 1216
7 SASI_Mm02_00299577 predicted 1772
8 SASI_Mm02_00299578 predicted 1232
9 SASI_Mm02_00299579 predicted 1247
10 SASI_Mm02_00299580 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326568 predicted 1610
2 SASI_Mm02_00326569 predicted 1860
3 SASI_Mm02_00326570 predicted 1186
4 SASI_Mm02_00326571 predicted 1515
5 SASI_Mm02_00326572 predicted 1768
6 SASI_Mm02_00326573 predicted 1290
7 SASI_Mm02_00326574 predicted 1843
8 SASI_Mm02_00326575 predicted 1299
9 SASI_Mm02_00326576 predicted 1318
10 SASI_Mm02_00326577 predicted 1561
11 SASI_Mm01_00048483 predicted 614
12 SASI_Mm01_00048484 predicted 930
13 SASI_Mm01_00048485 predicted 631
14 SASI_Mm01_00048486 predicted 682
15 SASI_Mm01_00048487 predicted 769
16 SASI_Mm01_00048488 predicted 648
17 SASI_Mm01_00048489 predicted 800
18 SASI_Mm01_00048490 predicted 865
19 SASI_Mm01_00048491 predicted 755
20 SASI_Mm01_00048492 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022332
VALIDATED
ST7 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.1-682s1c1
Sequence:CCGGCGGAATATAATCGGTACACTTCTCGAGAAGTGTACCGATTATATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.1-1698s1c1
Sequence:CCGGCCATACCCAATCTGTACAGAACTCGAGTTCTGTACAGATTGGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.2-1121s1c1
Sequence:CCGGCACCAATGTCTTAGTCTATATCTCGAGATATAGACTAAGACATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-874s21c1
Sequence:CCGGCCTTGGAGATAAACGAAATTACTCGAGTAATTTCGTTTATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-1335s21c1
Sequence:CCGGTTACCAAAGTCGGCGACAATACTCGAGTATTGTCGCCGACTTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-1121s21c1
Sequence:CCGGCACCAATGTCTTAGTCTATATCTCGAGATATAGACTAAGACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-2037s21c1
Sequence:CCGGCTCTCATGGACCGCAAGAAAGCTCGAGCTTTCTTGCGGTCCATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022332
VALIDATED
ST7 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.1-682s1c1
Sequence:CCGGCGGAATATAATCGGTACACTTCTCGAGAAGTGTACCGATTATATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.1-1698s1c1
Sequence:CCGGCCATACCCAATCTGTACAGAACTCGAGTTCTGTACAGATTGGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.2-1121s1c1
Sequence:CCGGCACCAATGTCTTAGTCTATATCTCGAGATATAGACTAAGACATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-874s21c1
Sequence:CCGGCCTTGGAGATAAACGAAATTACTCGAGTAATTTCGTTTATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-1335s21c1
Sequence:CCGGTTACCAAAGTCGGCGACAATACTCGAGTATTGTCGCCGACTTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-1121s21c1
Sequence:CCGGCACCAATGTCTTAGTCTATATCTCGAGATATAGACTAAGACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-2037s21c1
Sequence:CCGGCTCTCATGGACCGCAAGAAAGCTCGAGCTTTCTTGCGGTCCATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022332
VALIDATED
ST7 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.1-682s1c1
Sequence:CCGGCGGAATATAATCGGTACACTTCTCGAGAAGTGTACCGATTATATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.1-1698s1c1
Sequence:CCGGCCATACCCAATCTGTACAGAACTCGAGTTCTGTACAGATTGGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022332.2-1121s1c1
Sequence:CCGGCACCAATGTCTTAGTCTATATCTCGAGATATAGACTAAGACATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-874s21c1
Sequence:CCGGCCTTGGAGATAAACGAAATTACTCGAGTAATTTCGTTTATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-1335s21c1
Sequence:CCGGTTACCAAAGTCGGCGACAATACTCGAGTATTGTCGCCGACTTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-1121s21c1
Sequence:CCGGCACCAATGTCTTAGTCTATATCTCGAGATATAGACTAAGACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_022332.2-2037s21c1
Sequence:CCGGCTCTCATGGACCGCAAGAAAGCTCGAGCTTTCTTGCGGTCCATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018412
VALIDATED
ST7 MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018412.2-407s1c1
Sequence:CCGGCCTCACTAATATCAGGGCTTACTCGAGTAAGCCCTGATATTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-974s1c1
Sequence:CCGGCCCAGTATGAAGCCCAACATACTCGAGTATGTTGGGCTTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-1662s1c1
Sequence:CCGGGCTTCCCTTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018412.2-754s1c1
Sequence:CCGGGCAGATGCAATAATGCAGAAACTCGAGTTTCTGCATTATTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-1174s1c1
Sequence:CCGGGCTGATGTTCAGGCAGTCTTACTCGAGTAAGACTGCCTGAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-292s21c1
Sequence:CCGGGTGGTTCTTCATCGTGCTATTCTCGAGAATAGCACGATGAAGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-620s21c1
Sequence:CCGGTGGCGAAATCCACTAAATTTACTCGAGTAAATTTAGTGGATTTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018412.3-1190s21c1
Sequence:CCGGGCTGATGTTCAGGCAGTCTTACTCGAGTAAGACTGCCTGAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-1678s21c1
Sequence:CCGGGCTTCCCTTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-990s21c1
Sequence:CCGGCCCAGTATGAAGCCCAACATACTCGAGTATGTTGGGCTTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018412
VALIDATED
ST7 MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018412.2-407s1c1
Sequence:CCGGCCTCACTAATATCAGGGCTTACTCGAGTAAGCCCTGATATTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-974s1c1
Sequence:CCGGCCCAGTATGAAGCCCAACATACTCGAGTATGTTGGGCTTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-1662s1c1
Sequence:CCGGGCTTCCCTTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018412.2-754s1c1
Sequence:CCGGGCAGATGCAATAATGCAGAAACTCGAGTTTCTGCATTATTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-1174s1c1
Sequence:CCGGGCTGATGTTCAGGCAGTCTTACTCGAGTAAGACTGCCTGAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-292s21c1
Sequence:CCGGGTGGTTCTTCATCGTGCTATTCTCGAGAATAGCACGATGAAGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-620s21c1
Sequence:CCGGTGGCGAAATCCACTAAATTTACTCGAGTAAATTTAGTGGATTTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018412.3-1190s21c1
Sequence:CCGGGCTGATGTTCAGGCAGTCTTACTCGAGTAAGACTGCCTGAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-1678s21c1
Sequence:CCGGGCTTCCCTTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-990s21c1
Sequence:CCGGCCCAGTATGAAGCCCAACATACTCGAGTATGTTGGGCTTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018412
VALIDATED
ST7 MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018412.2-407s1c1
Sequence:CCGGCCTCACTAATATCAGGGCTTACTCGAGTAAGCCCTGATATTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-974s1c1
Sequence:CCGGCCCAGTATGAAGCCCAACATACTCGAGTATGTTGGGCTTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-1662s1c1
Sequence:CCGGGCTTCCCTTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018412.2-754s1c1
Sequence:CCGGGCAGATGCAATAATGCAGAAACTCGAGTTTCTGCATTATTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018412.2-1174s1c1
Sequence:CCGGGCTGATGTTCAGGCAGTCTTACTCGAGTAAGACTGCCTGAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-292s21c1
Sequence:CCGGGTGGTTCTTCATCGTGCTATTCTCGAGAATAGCACGATGAAGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-620s21c1
Sequence:CCGGTGGCGAAATCCACTAAATTTACTCGAGTAAATTTAGTGGATTTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018412.3-1190s21c1
Sequence:CCGGGCTGATGTTCAGGCAGTCTTACTCGAGTAAGACTGCCTGAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-1678s21c1
Sequence:CCGGGCTTCCCTTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018412.3-990s21c1
Sequence:CCGGCCCAGTATGAAGCCCAACATACTCGAGTATGTTGGGCTTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks