EMAIL THIS PAGE TO A FRIEND

ST7L

suppression of tumorigenicity 7 like

Synonyms: FAM4B ST7R STLR
Gene ID:
Human(54879) Summary: This gene was identified by its similarity to the ST7 tumor suppressor gene found in the chromosome 7q31 region. This gene is clustered in a tail-to-tail manner with the WNT2B gene in a chromosomal region known to be deleted and rearranged in a variety of cancers. Several transcript variants encoding many different isoforms have been described, but some have not been fully characterized. [provided by RefSeq, Feb 2011]
Mouse(229681) suppression of tumorigenicity 7-like
Rat(295344) suppression of tumorigenicity 7-like
Zebrafish(558013) suppression of tumorigenicity 7 like
chicken(395331) suppression of tumorigenicity 7 like
dog(612836) suppression of tumorigenicity 7 like
domestic cat(101097661) suppression of tumorigenicity 7 like
Horse(100059051) suppression of tumorigenicity 7 like
naked mole-rat(101703390) suppression of tumorigenicity 7 like
domestic guinea pig(100715279) suppression of tumorigenicity 7 like
cow(534657) suppression of tumorigenicity 7 like
sheep(101117032) suppression of tumorigenicity 7 like
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017744 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089441 MISSION® esiRNA esiRNA human ST7L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017744 Rosetta Predictions human pricing
NM_138727 Rosetta Predictions human pricing
NM_138728 Rosetta Predictions human pricing
NM_138729 Rosetta Predictions human pricing
NM_001007639 Rosetta Predictions rat pricing
NM_153091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045229 predicted 1092
2 SASI_Hs01_00045230 predicted 1160
3 SASI_Hs01_00045231 predicted 1146
4 SASI_Hs01_00045232 predicted 1164
5 SASI_Hs01_00045233 predicted 831
6 SASI_Hs01_00045234 predicted 1369
7 SASI_Hs01_00045235 predicted 1395
8 SASI_Hs01_00045236 predicted 946
9 SASI_Hs01_00045237 predicted 1471
10 SASI_Hs01_00045238 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040309 predicted 1044
2 SASI_Hs01_00040310 predicted 1108
3 SASI_Hs01_00040311 predicted 1101
4 SASI_Hs01_00040312 predicted 1112
5 SASI_Hs01_00040313 predicted 782
6 SASI_Hs01_00040314 predicted 1320
7 SASI_Hs01_00040315 predicted 1351
8 SASI_Hs01_00040316 predicted 894
9 SASI_Hs01_00040317 predicted 1413
10 SASI_Hs01_00040318 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199357 predicted 1101
2 SASI_Hs01_00199358 predicted 1160
3 SASI_Hs01_00199359 predicted 1149
4 SASI_Hs01_00199360 predicted 1163
5 SASI_Hs01_00199361 predicted 830
6 SASI_Hs01_00199362 predicted 1366
7 SASI_Hs01_00199363 predicted 1397
8 SASI_Hs01_00199364 predicted 950
9 SASI_Hs01_00199365 predicted 1473
10 SASI_Hs01_00199366 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241671 predicted 1095
2 SASI_Hs01_00241672 predicted 1157
3 SASI_Hs01_00241673 predicted 1145
4 SASI_Hs01_00241674 predicted 1159
5 SASI_Hs01_00241675 predicted 827
6 SASI_Hs01_00241676 predicted 1366
7 SASI_Hs01_00241677 predicted 1404
8 SASI_Hs01_00241678 predicted 945
9 SASI_Hs01_00241679 predicted 1469
10 SASI_Hs01_00241680 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103380 predicted 1575
2 SASI_Rn01_00103381 predicted 1076
3 SASI_Rn01_00103382 predicted 1146
4 SASI_Rn01_00103383 predicted 1959
5 SASI_Rn01_00103384 predicted 1469
6 SASI_Rn01_00103386 predicted 1906
7 SASI_Rn01_00103387 predicted 1318
8 SASI_Rn01_00103388 predicted 1047
9 SASI_Rn02_00198752 predicted 876
10 SASI_Rn02_00198753 predicted 1916
11 SASI_Rn01_00103385 predicted 1981
12 SASI_Rn01_00103389 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049593 predicted 1501
2 SASI_Mm01_00049594 predicted 1534
3 SASI_Mm01_00049595 predicted 1376
4 SASI_Mm01_00049596 predicted 262
5 SASI_Mm02_00342935 predicted 558
6 SASI_Mm01_00049597 predicted 461
7 SASI_Mm01_00049598 predicted 878
8 SASI_Mm01_00049599 predicted 291
9 SASI_Mm01_00049600 predicted 1469
10 SASI_Mm01_00049601 predicted 1646
11 SASI_Mm01_00049602 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153091
VALIDATED
ST7L MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 7 like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153091.2-1761s21c1
Sequence:CCGGGACGGCAAGAGCTGATGTAAACTCGAGTTTACATCAGCTCTTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153091.2-1526s21c1
Sequence:CCGGCGTCTCTGTCTATCCAAAGAACTCGAGTTCTTTGGATAGACAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153091.2-1785s21c1
Sequence:CCGGTCTACCATGACTGTGTCAAACCTCGAGGTTTGACACAGTCATGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153091.2-1242s21c1
Sequence:CCGGGCTGTGGAATTTAATCCTCATCTCGAGATGAGGATTAAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153091.2-1344s21c1
Sequence:CCGGGCCTATGCTTTCTTTCATCTACTCGAGTAGATGAAAGAAAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153091.2-256s21c1
Sequence:CCGGCCAAGTTCTATGTGGCACTTACTCGAGTAAGTGCCACATAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-557s1c1
Sequence:CCGGGCCACTTACTTACTATGACATCTCGAGATGTCATAGTAAGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-1526s1c1
Sequence:CCGGCGTCTCTGTCTATCCAAAGAACTCGAGTTCTTTGGATAGACAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-256s1c1
Sequence:CCGGCCAAGTTCTATGTGGCACTTACTCGAGTAAGTGCCACATAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-1242s1c1
Sequence:CCGGGCTGTGGAATTTAATCCTCATCTCGAGATGAGGATTAAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153091
VALIDATED
ST7L MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 7 like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153091.2-1761s21c1
Sequence:CCGGGACGGCAAGAGCTGATGTAAACTCGAGTTTACATCAGCTCTTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153091.2-1526s21c1
Sequence:CCGGCGTCTCTGTCTATCCAAAGAACTCGAGTTCTTTGGATAGACAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153091.2-1785s21c1
Sequence:CCGGTCTACCATGACTGTGTCAAACCTCGAGGTTTGACACAGTCATGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153091.2-1242s21c1
Sequence:CCGGGCTGTGGAATTTAATCCTCATCTCGAGATGAGGATTAAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153091.2-1344s21c1
Sequence:CCGGGCCTATGCTTTCTTTCATCTACTCGAGTAGATGAAAGAAAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153091.2-256s21c1
Sequence:CCGGCCAAGTTCTATGTGGCACTTACTCGAGTAAGTGCCACATAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-557s1c1
Sequence:CCGGGCCACTTACTTACTATGACATCTCGAGATGTCATAGTAAGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-1526s1c1
Sequence:CCGGCGTCTCTGTCTATCCAAAGAACTCGAGTTCTTTGGATAGACAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-256s1c1
Sequence:CCGGCCAAGTTCTATGTGGCACTTACTCGAGTAAGTGCCACATAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-1242s1c1
Sequence:CCGGGCTGTGGAATTTAATCCTCATCTCGAGATGAGGATTAAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153091
VALIDATED
ST7L MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 7 like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153091.2-1761s21c1
Sequence:CCGGGACGGCAAGAGCTGATGTAAACTCGAGTTTACATCAGCTCTTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153091.2-1526s21c1
Sequence:CCGGCGTCTCTGTCTATCCAAAGAACTCGAGTTCTTTGGATAGACAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153091.2-1785s21c1
Sequence:CCGGTCTACCATGACTGTGTCAAACCTCGAGGTTTGACACAGTCATGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153091.2-1242s21c1
Sequence:CCGGGCTGTGGAATTTAATCCTCATCTCGAGATGAGGATTAAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153091.2-1344s21c1
Sequence:CCGGGCCTATGCTTTCTTTCATCTACTCGAGTAGATGAAAGAAAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153091.2-256s21c1
Sequence:CCGGCCAAGTTCTATGTGGCACTTACTCGAGTAAGTGCCACATAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-557s1c1
Sequence:CCGGGCCACTTACTTACTATGACATCTCGAGATGTCATAGTAAGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-1526s1c1
Sequence:CCGGCGTCTCTGTCTATCCAAAGAACTCGAGTTCTTTGGATAGACAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-256s1c1
Sequence:CCGGCCAAGTTCTATGTGGCACTTACTCGAGTAAGTGCCACATAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153091.2-1242s1c1
Sequence:CCGGGCTGTGGAATTTAATCCTCATCTCGAGATGAGGATTAAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017744
ST7L MISSION shRNA Bacterial Glycerol Stock
suppression of tumorigenicity 7 like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-1969s1c1
Sequence:CCGGCCTCAGGCTTTGAGGAGAATACTCGAGTATTCTCCTCAAAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-963s1c1
Sequence:CCGGGCTCGAATCAAAGCAGCCTATCTCGAGATAGGCTGCTTTGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-739s1c1
Sequence:CCGGGCAGACAGAATTTGTCAGAATCTCGAGATTCTGACAAATTCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-1795s1c1
Sequence:CCGGCCTTTCATCATGTTTCTGTTTCTCGAGAAACAGAAACATGATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-537s1c1
Sequence:CCGGCCCAAATTCTATGTGGCACTTCTCGAGAAGTGCCACATAGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017744
ST7L MISSION shRNA shRNA Plasmid DNA
suppression of tumorigenicity 7 like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-1969s1c1
Sequence:CCGGCCTCAGGCTTTGAGGAGAATACTCGAGTATTCTCCTCAAAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-963s1c1
Sequence:CCGGGCTCGAATCAAAGCAGCCTATCTCGAGATAGGCTGCTTTGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-739s1c1
Sequence:CCGGGCAGACAGAATTTGTCAGAATCTCGAGATTCTGACAAATTCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-1795s1c1
Sequence:CCGGCCTTTCATCATGTTTCTGTTTCTCGAGAAACAGAAACATGATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-537s1c1
Sequence:CCGGCCCAAATTCTATGTGGCACTTCTCGAGAAGTGCCACATAGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017744
ST7L MISSION shRNA Lentiviral Transduction Particles
suppression of tumorigenicity 7 like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-1969s1c1
Sequence:CCGGCCTCAGGCTTTGAGGAGAATACTCGAGTATTCTCCTCAAAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-963s1c1
Sequence:CCGGGCTCGAATCAAAGCAGCCTATCTCGAGATAGGCTGCTTTGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-739s1c1
Sequence:CCGGGCAGACAGAATTTGTCAGAATCTCGAGATTCTGACAAATTCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-1795s1c1
Sequence:CCGGCCTTTCATCATGTTTCTGTTTCTCGAGAAACAGAAACATGATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017744.4-537s1c1
Sequence:CCGGCCCAAATTCTATGTGGCACTTCTCGAGAAGTGCCACATAGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks