EMAIL THIS PAGE TO A FRIEND

ST8SIA1

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1

Synonyms: GD3S SIAT8 SIAT8-A SIAT8A ST8SiaI
UniProtKB ID: Q92185, A8K4H6, Q17RL0, Q6PZN5, Q93064
Gene ID:
Human(6489) Summary: Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
Mouse(20449) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Rat(25280) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Zebrafish(553210) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
domestic cat(101093029) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Horse(100064415) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
dog(477672) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
chicken(395860) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
cow(282352) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
sheep(101117321) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
domestic guinea pig(100715414) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
naked mole-rat(101696963) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Domestic Rabbit(100351155) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003034 Rosetta Predictions human pricing
NM_012813 Rosetta Predictions rat pricing
NM_011374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145683 predicted 1021
2 SASI_Hs01_00145684 predicted 939
3 SASI_Hs01_00145685 predicted 1200
4 SASI_Hs01_00145686 predicted 996
5 SASI_Hs01_00145687 predicted 1235
6 SASI_Hs01_00145688 predicted 937
7 SASI_Hs01_00145690 predicted 1175
8 SASI_Hs01_00145691 predicted 982
9 SASI_Hs02_00334939 predicted 1240
10 SASI_Hs01_00145692 predicted 1048
11 SASI_Hs01_00145689 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121856 predicted 805
2 SASI_Rn01_00121858 predicted 617
3 SASI_Rn01_00121859 predicted 373
4 SASI_Rn01_00121860 predicted 734
5 SASI_Rn01_00121861 predicted 543
6 SASI_Rn01_00121862 predicted 855
7 SASI_Rn01_00121863 predicted 755
8 SASI_Rn01_00121864 predicted 570
9 SASI_Rn01_00121865 predicted 306
10 SASI_Rn02_00260263 predicted 585
11 SASI_Rn01_00121857 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032493 predicted 1246
2 SASI_Mm01_00032494 predicted 1492
3 SASI_Mm02_00320552 predicted 814
4 SASI_Mm01_00032495 predicted 1375
5 SASI_Mm01_00032496 predicted 1398
6 SASI_Mm01_00032497 predicted 1203
7 SASI_Mm01_00032498 predicted 1434
8 SASI_Mm01_00032499 predicted 1531
9 SASI_Mm01_00032500 predicted 1005
10 SASI_Mm01_00032501 predicted 1386
11 SASI_Mm01_00032502 predicted 1173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011374
ST8SIA1 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011374.2-8078s1c1
Sequence:CCGGGCCTGCTTCATCTTTAACAAACTCGAGTTTGTTAAAGATGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1380s1c1
Sequence:CCGGCCGTGTGTATTACACACTGAACTCGAGTTCAGTGTGTAATACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1247s1c1
Sequence:CCGGCCAGCATAATTCGCCAGAGATCTCGAGATCTCTGGCGAATTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1011s1c1
Sequence:CCGGGCTCTTATACTCGTTCACCATCTCGAGATGGTGAACGAGTATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1495s1c1
Sequence:CCGGCGCTTGTCTACAGGACTCTTTCTCGAGAAAGAGTCCTGTAGACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011374
ST8SIA1 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011374.2-8078s1c1
Sequence:CCGGGCCTGCTTCATCTTTAACAAACTCGAGTTTGTTAAAGATGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1380s1c1
Sequence:CCGGCCGTGTGTATTACACACTGAACTCGAGTTCAGTGTGTAATACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1247s1c1
Sequence:CCGGCCAGCATAATTCGCCAGAGATCTCGAGATCTCTGGCGAATTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1011s1c1
Sequence:CCGGGCTCTTATACTCGTTCACCATCTCGAGATGGTGAACGAGTATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1495s1c1
Sequence:CCGGCGCTTGTCTACAGGACTCTTTCTCGAGAAAGAGTCCTGTAGACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011374
ST8SIA1 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011374.2-8078s1c1
Sequence:CCGGGCCTGCTTCATCTTTAACAAACTCGAGTTTGTTAAAGATGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1380s1c1
Sequence:CCGGCCGTGTGTATTACACACTGAACTCGAGTTCAGTGTGTAATACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1247s1c1
Sequence:CCGGCCAGCATAATTCGCCAGAGATCTCGAGATCTCTGGCGAATTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1011s1c1
Sequence:CCGGGCTCTTATACTCGTTCACCATCTCGAGATGGTGAACGAGTATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011374.2-1495s1c1
Sequence:CCGGCGCTTGTCTACAGGACTCTTTCTCGAGAAAGAGTCCTGTAGACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003034
ST8SIA1 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-1239s1c1
Sequence:CCGGCCCAACTTTCTGCGTAGCATTCTCGAGAATGCTACGCAGAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-748s1c1
Sequence:CCGGCCCATCTCTTTGCTATGACTACTCGAGTAGTCATAGCAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-940s1c1
Sequence:CCGGGCCGTCAAATAGATGAAGCAACTCGAGTTGCTTCATCTATTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003034.3-1932s21c1
Sequence:CCGGCAACACAAACTGGCTTAATAACTCGAGTTATTAAGCCAGTTTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003034.3-1710s21c1
Sequence:CCGGGTTGGCTTGGAGGACAAATAACTCGAGTTATTTGTCCTCCAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003034.3-1171s21c1
Sequence:CCGGAGCCATCTTTGAGGGTTTATTCTCGAGAATAAACCCTCAAAGATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003034
ST8SIA1 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-1239s1c1
Sequence:CCGGCCCAACTTTCTGCGTAGCATTCTCGAGAATGCTACGCAGAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-748s1c1
Sequence:CCGGCCCATCTCTTTGCTATGACTACTCGAGTAGTCATAGCAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-940s1c1
Sequence:CCGGGCCGTCAAATAGATGAAGCAACTCGAGTTGCTTCATCTATTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003034.3-1932s21c1
Sequence:CCGGCAACACAAACTGGCTTAATAACTCGAGTTATTAAGCCAGTTTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003034.3-1710s21c1
Sequence:CCGGGTTGGCTTGGAGGACAAATAACTCGAGTTATTTGTCCTCCAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003034.3-1171s21c1
Sequence:CCGGAGCCATCTTTGAGGGTTTATTCTCGAGAATAAACCCTCAAAGATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003034
ST8SIA1 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-1239s1c1
Sequence:CCGGCCCAACTTTCTGCGTAGCATTCTCGAGAATGCTACGCAGAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-748s1c1
Sequence:CCGGCCCATCTCTTTGCTATGACTACTCGAGTAGTCATAGCAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003034.2-940s1c1
Sequence:CCGGGCCGTCAAATAGATGAAGCAACTCGAGTTGCTTCATCTATTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003034.3-1932s21c1
Sequence:CCGGCAACACAAACTGGCTTAATAACTCGAGTTATTAAGCCAGTTTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003034.3-1710s21c1
Sequence:CCGGGTTGGCTTGGAGGACAAATAACTCGAGTTATTTGTCCTCCAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003034.3-1171s21c1
Sequence:CCGGAGCCATCTTTGAGGGTTTATTCTCGAGAATAAACCCTCAAAGATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks