EMAIL THIS PAGE TO A FRIEND

ST8SIA2

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2

Synonyms: HsT19690 SIAT8B ST8SIA-II STX
UniProtKB ID: Q92186, Q4VAZ0, Q92470, Q92746
Gene ID:
Human(8128) Summary: The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
Mouse(20450) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Rat(117523) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
naked mole-rat(101717887) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
domestic guinea pig(100733437) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
cow(540267) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
sheep(101114980) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Zebrafish(555134) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
domestic cat(101096068) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
dog(488722) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
chicken(414336) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
248 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020411 MISSION® esiRNA esiRNA human ST8SIA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006011 Rosetta Predictions human pricing
NM_057156 Rosetta Predictions rat pricing
XM_579600 Rosetta Predictions rat pricing
NM_009181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163836 predicted 1062
2 SASI_Hs01_00163837 predicted 543
3 SASI_Hs01_00163838 predicted 1182
4 SASI_Hs01_00163839 predicted 1123
5 SASI_Hs01_00163840 predicted 288
6 SASI_Hs01_00163841 predicted 336
7 SASI_Hs01_00163842 predicted 787
8 SASI_Hs01_00163843 predicted 1001
9 SASI_Hs01_00163844 predicted 513
10 SASI_Hs01_00163845 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032621 predicted 442
2 SASI_Rn01_00032622 predicted 313
3 SASI_Rn01_00032623 predicted 512
4 SASI_Rn01_00032625 predicted 355
5 SASI_Rn01_00032626 predicted 760
6 SASI_Rn01_00032627 predicted 874
7 SASI_Rn01_00032629 predicted 791
8 SASI_Rn01_00032630 predicted 431
9 SASI_Rn02_00267122 predicted 402
10 SASI_Rn02_00267123 predicted 342
11 SASI_Rn01_00032624 predicted 639
12 SASI_Rn01_00032628 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171082 predicted 654
2 SASI_Rn01_00171083 predicted 657
3 SASI_Rn01_00171084 predicted 749
4 SASI_Rn01_00171085 predicted 664
5 SASI_Rn01_00171086 predicted 780
6 SASI_Rn01_00171087 predicted 742
7 SASI_Rn01_00171088 predicted 692
8 SASI_Rn01_00171089 predicted 706
9 SASI_Rn01_00171090 predicted 738
10 SASI_Rn01_00171091 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069752 predicted 628
2 SASI_Mm01_00069754 predicted 705
3 SASI_Mm01_00069755 predicted 1101
4 SASI_Mm01_00069756 predicted 1027
5 SASI_Mm01_00069758 predicted 323
6 SASI_Mm02_00315549 predicted 1020
7 SASI_Mm01_00069759 predicted 338
8 SASI_Mm01_00069760 predicted 315
9 SASI_Mm01_00069761 predicted 393
10 SASI_Mm02_00315550 predicted 701
11 SASI_Mm01_00069753 predicted 523
12 SASI_Mm01_00069757 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006011
ST8SIA2 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-378s1c1
Sequence:CCGGGCCTGGAGATATTATTCATTACTCGAGTAATGAATAATATCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-220s1c1
Sequence:CCGGGCTGTTGTTGACAGAAGTAATCTCGAGATTACTTCTGTCAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-162s1c1
Sequence:CCGGCAGCTTACATAGCAAATCTAACTCGAGTTAGATTTGCTATGTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-1000s1c1
Sequence:CCGGCCAGTCAAGTACCACTATTATCTCGAGATAATAGTGGTACTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-932s1c1
Sequence:CCGGCCACACGTTTCTGCAAACAAACTCGAGTTTGTTTGCAGAAACGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006011
ST8SIA2 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-378s1c1
Sequence:CCGGGCCTGGAGATATTATTCATTACTCGAGTAATGAATAATATCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-220s1c1
Sequence:CCGGGCTGTTGTTGACAGAAGTAATCTCGAGATTACTTCTGTCAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-162s1c1
Sequence:CCGGCAGCTTACATAGCAAATCTAACTCGAGTTAGATTTGCTATGTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-1000s1c1
Sequence:CCGGCCAGTCAAGTACCACTATTATCTCGAGATAATAGTGGTACTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-932s1c1
Sequence:CCGGCCACACGTTTCTGCAAACAAACTCGAGTTTGTTTGCAGAAACGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006011
ST8SIA2 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-378s1c1
Sequence:CCGGGCCTGGAGATATTATTCATTACTCGAGTAATGAATAATATCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-220s1c1
Sequence:CCGGGCTGTTGTTGACAGAAGTAATCTCGAGATTACTTCTGTCAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-162s1c1
Sequence:CCGGCAGCTTACATAGCAAATCTAACTCGAGTTAGATTTGCTATGTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-1000s1c1
Sequence:CCGGCCAGTCAAGTACCACTATTATCTCGAGATAATAGTGGTACTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006011.2-932s1c1
Sequence:CCGGCCACACGTTTCTGCAAACAAACTCGAGTTTGTTTGCAGAAACGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009181
ST8SIA2 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009181.1-2786s1c1
Sequence:CCGGGCCTGATAAATAATGGTGTTTCTCGAGAAACACCATTATTTATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-522s1c1
Sequence:CCGGCCTGGAGACATTATTCATTATCTCGAGATAATGAATAATGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-234s1c1
Sequence:CCGGGCAGACATCTCAGAGATCGAACTCGAGTTCGATCTCTGAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-1168s1c1
Sequence:CCGGGCCTCAAGTATGGCTACACTTCTCGAGAAGTGTAGCCATACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-1143s1c1
Sequence:CCGGCCCGTCAAGTATCACTATTATCTCGAGATAATAGTGATACTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009181
ST8SIA2 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009181.1-2786s1c1
Sequence:CCGGGCCTGATAAATAATGGTGTTTCTCGAGAAACACCATTATTTATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-522s1c1
Sequence:CCGGCCTGGAGACATTATTCATTATCTCGAGATAATGAATAATGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-234s1c1
Sequence:CCGGGCAGACATCTCAGAGATCGAACTCGAGTTCGATCTCTGAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-1168s1c1
Sequence:CCGGGCCTCAAGTATGGCTACACTTCTCGAGAAGTGTAGCCATACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-1143s1c1
Sequence:CCGGCCCGTCAAGTATCACTATTATCTCGAGATAATAGTGATACTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009181
ST8SIA2 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009181.1-2786s1c1
Sequence:CCGGGCCTGATAAATAATGGTGTTTCTCGAGAAACACCATTATTTATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-522s1c1
Sequence:CCGGCCTGGAGACATTATTCATTATCTCGAGATAATGAATAATGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-234s1c1
Sequence:CCGGGCAGACATCTCAGAGATCGAACTCGAGTTCGATCTCTGAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-1168s1c1
Sequence:CCGGGCCTCAAGTATGGCTACACTTCTCGAGAAGTGTAGCCATACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009181.1-1143s1c1
Sequence:CCGGCCCGTCAAGTATCACTATTATCTCGAGATAATAGTGATACTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks