EMAIL THIS PAGE TO A FRIEND

ST8SIA3

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3

Synonyms: SIAT8C ST8SiaIII
UniProtKB ID: O43173, A8K0F2, Q6B085, Q9NS41
Gene ID:
Human(51046) Summary: ST8SIA3 belongs to a family of sialyltransferases that form sialyl-alpha-2,8-sialyl-R linkages at the nonreducing termini of glycoconjugates (Lee et al., 1998 [PubMed 9826427]
Mouse(20451) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Rat(25547) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Zebrafish(553510) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
domestic cat(101100510) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Horse(100053917) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
dog(612940) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
chicken(414796) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
cow(414349) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
sheep(101114742) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
domestic guinea pig(100731035) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
naked mole-rat(101712436) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015879 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014031 MISSION® esiRNA esiRNA targeting mouse St8sia3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015879 Rosetta Predictions human pricing
NM_013029 Rosetta Predictions rat pricing
NM_009182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192518 predicted 1496
2 SASI_Hs01_00192519 predicted 739
3 SASI_Hs01_00192520 predicted 1492
4 SASI_Hs02_00348462 predicted 1560
5 SASI_Hs01_00192521 predicted 529
6 SASI_Hs01_00192522 predicted 1202
7 SASI_Hs01_00192523 predicted 1294
8 SASI_Hs01_00192525 predicted 605
9 SASI_Hs02_00348463 predicted 970
10 SASI_Hs01_00192526 predicted 1023
11 SASI_Hs01_00192524 predicted 2616
12 SASI_Hs01_00192527 predicted 2391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065864 predicted 1185
2 SASI_Rn01_00065865 predicted 503
3 SASI_Rn01_00065866 predicted 418
4 SASI_Rn01_00065867 predicted 508
5 SASI_Rn02_00260721 predicted 728
6 SASI_Rn01_00065868 predicted 230
7 SASI_Rn01_00065869 predicted 901
8 SASI_Rn01_00065870 predicted 1005
9 SASI_Rn01_00065871 predicted 1078
10 SASI_Rn01_00065872 predicted 346
11 SASI_Rn01_00065873 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200520 predicted 551
2 SASI_Mm01_00200521 predicted 1218
3 SASI_Mm01_00200522 predicted 448
4 SASI_Mm01_00200523 predicted 1298
5 SASI_Mm01_00200524 predicted 307
6 SASI_Mm01_00200525 predicted 930
7 SASI_Mm01_00200526 predicted 669
8 SASI_Mm01_00200527 predicted 1107
9 SASI_Mm01_00200528 predicted 996
10 SASI_Mm01_00200529 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015879
ST8SIA3 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2855s1c1
Sequence:CCGGCCGGGAAATATAATGCAACATCTCGAGATGTTGCATTATATTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2407s1c1
Sequence:CCGGCTATGATTATTCCAGCCATAACTCGAGTTATGGCTGGAATAATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2203s1c1
Sequence:CCGGGTCACAATTTGCGCTGAAGTTCTCGAGAACTTCAGCGCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2917s1c1
Sequence:CCGGGCTGAGCACAGGTATTCTTATCTCGAGATAAGAATACCTGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015879.2-1506s21c1
Sequence:CCGGCCAAACGGAAAGCGCCAAATGCTCGAGCATTTGGCGCTTTCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015879.2-669s21c1
Sequence:CCGGTCTTCAGCATGTCGATGTAATCTCGAGATTACATCGACATGCTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015879.2-1593s21c1
Sequence:CCGGTAAGGATTGTCTGCCATTTAACTCGAGTTAAATGGCAGACAATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015879
ST8SIA3 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2855s1c1
Sequence:CCGGCCGGGAAATATAATGCAACATCTCGAGATGTTGCATTATATTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2407s1c1
Sequence:CCGGCTATGATTATTCCAGCCATAACTCGAGTTATGGCTGGAATAATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2203s1c1
Sequence:CCGGGTCACAATTTGCGCTGAAGTTCTCGAGAACTTCAGCGCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2917s1c1
Sequence:CCGGGCTGAGCACAGGTATTCTTATCTCGAGATAAGAATACCTGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015879.2-1506s21c1
Sequence:CCGGCCAAACGGAAAGCGCCAAATGCTCGAGCATTTGGCGCTTTCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015879.2-669s21c1
Sequence:CCGGTCTTCAGCATGTCGATGTAATCTCGAGATTACATCGACATGCTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015879.2-1593s21c1
Sequence:CCGGTAAGGATTGTCTGCCATTTAACTCGAGTTAAATGGCAGACAATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015879
ST8SIA3 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2855s1c1
Sequence:CCGGCCGGGAAATATAATGCAACATCTCGAGATGTTGCATTATATTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2407s1c1
Sequence:CCGGCTATGATTATTCCAGCCATAACTCGAGTTATGGCTGGAATAATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2203s1c1
Sequence:CCGGGTCACAATTTGCGCTGAAGTTCTCGAGAACTTCAGCGCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015879.1-2917s1c1
Sequence:CCGGGCTGAGCACAGGTATTCTTATCTCGAGATAAGAATACCTGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015879.2-1506s21c1
Sequence:CCGGCCAAACGGAAAGCGCCAAATGCTCGAGCATTTGGCGCTTTCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015879.2-669s21c1
Sequence:CCGGTCTTCAGCATGTCGATGTAATCTCGAGATTACATCGACATGCTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015879.2-1593s21c1
Sequence:CCGGTAAGGATTGTCTGCCATTTAACTCGAGTTAAATGGCAGACAATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009182
ST8SIA3 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009182.2-4994s1c1
Sequence:CCGGCCCTTGAGTTAAGAAACATTTCTCGAGAAATGTTTCTTAACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-289s1c1
Sequence:CCGGGACCAGTCATTTGTGCCCATTCTCGAGAATGGGCACAAATGACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-844s1c1
Sequence:CCGGGCAACTGTAACGAGAACGCTACTCGAGTAGCGTTCTCGTTACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-465s1c1
Sequence:CCGGGCATTATGATTATTCCAGCCACTCGAGTGGCTGGAATAATCATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-540s1c1
Sequence:CCGGGCCCATTATGAATAAGCGTTACTCGAGTAACGCTTATTCATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009182
ST8SIA3 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009182.2-4994s1c1
Sequence:CCGGCCCTTGAGTTAAGAAACATTTCTCGAGAAATGTTTCTTAACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-289s1c1
Sequence:CCGGGACCAGTCATTTGTGCCCATTCTCGAGAATGGGCACAAATGACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-844s1c1
Sequence:CCGGGCAACTGTAACGAGAACGCTACTCGAGTAGCGTTCTCGTTACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-465s1c1
Sequence:CCGGGCATTATGATTATTCCAGCCACTCGAGTGGCTGGAATAATCATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-540s1c1
Sequence:CCGGGCCCATTATGAATAAGCGTTACTCGAGTAACGCTTATTCATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009182
ST8SIA3 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009182.2-4994s1c1
Sequence:CCGGCCCTTGAGTTAAGAAACATTTCTCGAGAAATGTTTCTTAACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-289s1c1
Sequence:CCGGGACCAGTCATTTGTGCCCATTCTCGAGAATGGGCACAAATGACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-844s1c1
Sequence:CCGGGCAACTGTAACGAGAACGCTACTCGAGTAGCGTTCTCGTTACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-465s1c1
Sequence:CCGGGCATTATGATTATTCCAGCCACTCGAGTGGCTGGAATAATCATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009182.2-540s1c1
Sequence:CCGGGCCCATTATGAATAAGCGTTACTCGAGTAACGCTTATTCATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks