EMAIL THIS PAGE TO A FRIEND

ST8SIA4

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4

Synonyms: PST PST1 SIAT8D ST8SIA-IV
UniProtKB ID: Q92187, A8KA07, G3V104, Q8N1F4, Q92693
Gene ID:
Human(7903) Summary: The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20452) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Rat(116696) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
naked mole-rat(101714590) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
domestic guinea pig(100716689) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
cow(407768) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
sheep(101112314) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Zebrafish(553211) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
chicken(374155) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Horse(100064780) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
domestic cat(101084341) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
dog(488886) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
256 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056521 MISSION® esiRNA esiRNA human ST8SIA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005668 Rosetta Predictions human pricing
NM_175052 Rosetta Predictions human pricing
NM_053914 Rosetta Predictions rat pricing
NM_009183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221612 predicted 339
2 SASI_Hs01_00221615 predicted 590
3 SASI_Hs01_00221616 predicted 549
4 SASI_Hs01_00221617 predicted 586
5 SASI_Hs02_00340048 predicted 436
6 SASI_Hs01_00221619 predicted 523
7 SASI_Hs01_00221620 predicted 472
8 SASI_Hs01_00221621 predicted 555
9 SASI_Hs02_00340049 predicted 409
10 SASI_Hs02_00340050 predicted 554
11 SASI_Hs01_00221613 predicted 441
12 SASI_Hs01_00221614 predicted 572
13 SASI_Hs01_00221618 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083150 predicted 344
2 SASI_Hs01_00083153 predicted 597
3 SASI_Hs01_00083154 predicted 551
4 SASI_Hs01_00083155 predicted 585
5 SASI_Hs02_00368943 predicted 438
6 SASI_Hs01_00083157 predicted 523
7 SASI_Hs01_00083158 predicted 472
8 SASI_Hs01_00083159 predicted 554
9 SASI_Hs02_00368944 predicted 418
10 SASI_Hs02_00368945 predicted 554
11 SASI_Hs01_00083151 predicted 435
12 SASI_Hs01_00083152 predicted 565
13 SASI_Hs01_00083156 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266849 predicted 697
2 SASI_Rn02_00266850 predicted 690
3 SASI_Rn02_00266851 predicted 994
4 SASI_Rn02_00266852 predicted 1073
5 SASI_Rn02_00266853 predicted 466
6 SASI_Rn02_00266854 predicted 520
7 SASI_Rn02_00266855 predicted 417
8 SASI_Rn02_00266856 predicted 532
9 SASI_Rn02_00266857 predicted 1005
10 SASI_Rn02_00266858 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174440 predicted 745
2 SASI_Mm01_00174441 predicted 1217
3 SASI_Mm01_00174442 predicted 1357
4 SASI_Mm01_00174443 predicted 1200
5 SASI_Mm01_00174444 predicted 1045
6 SASI_Mm01_00174445 predicted 916
7 SASI_Mm01_00174446 predicted 1500
8 SASI_Mm01_00174447 predicted 895
9 SASI_Mm01_00174448 predicted 364
10 SASI_Mm02_00315551 predicted 456
11 SASI_Mm01_00174439 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005668
VALIDATED
ST8SIA4 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1032s21c1
Sequence:CCGGAGCACGTGGAGTGGGTTAATGCTCGAGCATTAACCCACTCCACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005668.4-1679s21c1
Sequence:CCGGAGTGCACTCATCATTAGTTAACTCGAGTTAACTAATGATGAGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1258s21c1
Sequence:CCGGAGCGGTCAAATATCATTATTACTCGAGTAATAATGATATTTGACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1091s21c1
Sequence:CCGGTATCCGTCATTGAGACTTATTCTCGAGAATAAGTCTCAATGACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-708s1c1
Sequence:CCGGCCAATGAAGAATCGCAGGTTTCTCGAGAAACCTGCGATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-1299s1c1
Sequence:CCGGCCTCACAGAATGCCATTAGAACTCGAGTTCTAATGGCATTCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-657s1c1
Sequence:CCGGCGGACACTAAACATTTCTCATCTCGAGATGAGAAATGTTTAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005668.3-1115s1c1
Sequence:CCGGGCTGACCAACAAAGTTCCTATCTCGAGATAGGAACTTTGTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-1174s1c1
Sequence:CCGGCCACAAGATTCTGTGATGAAACTCGAGTTTCATCACAGAATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005668
VALIDATED
ST8SIA4 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1032s21c1
Sequence:CCGGAGCACGTGGAGTGGGTTAATGCTCGAGCATTAACCCACTCCACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005668.4-1679s21c1
Sequence:CCGGAGTGCACTCATCATTAGTTAACTCGAGTTAACTAATGATGAGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1258s21c1
Sequence:CCGGAGCGGTCAAATATCATTATTACTCGAGTAATAATGATATTTGACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1091s21c1
Sequence:CCGGTATCCGTCATTGAGACTTATTCTCGAGAATAAGTCTCAATGACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-708s1c1
Sequence:CCGGCCAATGAAGAATCGCAGGTTTCTCGAGAAACCTGCGATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-1299s1c1
Sequence:CCGGCCTCACAGAATGCCATTAGAACTCGAGTTCTAATGGCATTCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-657s1c1
Sequence:CCGGCGGACACTAAACATTTCTCATCTCGAGATGAGAAATGTTTAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005668.3-1115s1c1
Sequence:CCGGGCTGACCAACAAAGTTCCTATCTCGAGATAGGAACTTTGTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-1174s1c1
Sequence:CCGGCCACAAGATTCTGTGATGAAACTCGAGTTTCATCACAGAATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005668
VALIDATED
ST8SIA4 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1032s21c1
Sequence:CCGGAGCACGTGGAGTGGGTTAATGCTCGAGCATTAACCCACTCCACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005668.4-1679s21c1
Sequence:CCGGAGTGCACTCATCATTAGTTAACTCGAGTTAACTAATGATGAGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1258s21c1
Sequence:CCGGAGCGGTCAAATATCATTATTACTCGAGTAATAATGATATTTGACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005668.4-1091s21c1
Sequence:CCGGTATCCGTCATTGAGACTTATTCTCGAGAATAAGTCTCAATGACGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-708s1c1
Sequence:CCGGCCAATGAAGAATCGCAGGTTTCTCGAGAAACCTGCGATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-1299s1c1
Sequence:CCGGCCTCACAGAATGCCATTAGAACTCGAGTTCTAATGGCATTCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-657s1c1
Sequence:CCGGCGGACACTAAACATTTCTCATCTCGAGATGAGAAATGTTTAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005668.3-1115s1c1
Sequence:CCGGGCTGACCAACAAAGTTCCTATCTCGAGATAGGAACTTTGTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005668.3-1174s1c1
Sequence:CCGGCCACAAGATTCTGTGATGAAACTCGAGTTTCATCACAGAATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009183
ST8SIA4 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-718s1c1
Sequence:CCGGCCTGAAGTTTCACCAATGAAACTCGAGTTTCATTGGTGAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-717s1c1
Sequence:CCGGGCCTGAAGTTTCACCAATGAACTCGAGTTCATTGGTGAAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-1196s1c1
Sequence:CCGGCCACCAGATTCTGTGATGAAACTCGAGTTTCATCACAGAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-1137s1c1
Sequence:CCGGGCTGACTAACAAAGTTCCTATCTCGAGATAGGAACTTTGTTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009183.1-2451s1c1
Sequence:CCGGCCCAGGTAGATTGTTCGGATTCTCGAGAATCCGAACAATCTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009183
ST8SIA4 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-718s1c1
Sequence:CCGGCCTGAAGTTTCACCAATGAAACTCGAGTTTCATTGGTGAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-717s1c1
Sequence:CCGGGCCTGAAGTTTCACCAATGAACTCGAGTTCATTGGTGAAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-1196s1c1
Sequence:CCGGCCACCAGATTCTGTGATGAAACTCGAGTTTCATCACAGAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-1137s1c1
Sequence:CCGGGCTGACTAACAAAGTTCCTATCTCGAGATAGGAACTTTGTTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009183.1-2451s1c1
Sequence:CCGGCCCAGGTAGATTGTTCGGATTCTCGAGAATCCGAACAATCTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009183
ST8SIA4 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-718s1c1
Sequence:CCGGCCTGAAGTTTCACCAATGAAACTCGAGTTTCATTGGTGAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-717s1c1
Sequence:CCGGGCCTGAAGTTTCACCAATGAACTCGAGTTCATTGGTGAAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-1196s1c1
Sequence:CCGGCCACCAGATTCTGTGATGAAACTCGAGTTTCATCACAGAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009183.1-1137s1c1
Sequence:CCGGGCTGACTAACAAAGTTCCTATCTCGAGATAGGAACTTTGTTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009183.1-2451s1c1
Sequence:CCGGCCCAGGTAGATTGTTCGGATTCTCGAGAATCCGAACAATCTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks