EMAIL THIS PAGE TO A FRIEND

ST8SIA5

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5

Synonyms: SIAT8E ST8SiaV
UniProtKB ID: O15466, Q6IAW7
Gene ID:
Human(29906) Summary: The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Mouse(225742) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Rat(364901) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Zebrafish(553754) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Horse(100068868) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
domestic cat(101085668) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
chicken(414797) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
dog(100036755) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
cow(497020) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
sheep(101110108) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
domestic guinea pig(100728347) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
naked mole-rat(101708460) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043101 MISSION® esiRNA esiRNA human ST8SIA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013305 Rosetta Predictions human pricing
NM_213628 Rosetta Predictions rat pricing
NM_153124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038653 predicted 865
2 SASI_Hs01_00038654 predicted 758
3 SASI_Hs01_00038655 predicted 1030
4 SASI_Hs01_00038656 predicted 2121
5 SASI_Hs01_00038657 predicted 2118
6 SASI_Hs01_00038658 predicted 1026
7 SASI_Hs01_00038659 predicted 836
8 SASI_Hs01_00038660 predicted 2111
9 SASI_Hs01_00038661 predicted 1183
10 SASI_Hs01_00038662 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064229 predicted 245
2 SASI_Rn01_00064230 predicted 619
3 SASI_Rn01_00064231 predicted 758
4 SASI_Rn01_00064232 predicted 310
5 SASI_Rn01_00064233 predicted 455
6 SASI_Rn01_00064234 predicted 229
7 SASI_Rn01_00064235 predicted 821
8 SASI_Rn01_00064236 predicted 757
9 SASI_Rn02_00270619 predicted 593
10 SASI_Rn01_00064237 predicted 295
11 SASI_Rn01_00064238 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069872 predicted 791
2 SASI_Mm01_00069873 predicted 1588
3 SASI_Mm01_00069874 predicted 704
4 SASI_Mm01_00069875 predicted 783
5 SASI_Mm01_00069876 predicted 503
6 SASI_Mm01_00069877 predicted 399
7 SASI_Mm01_00069878 predicted 1504
8 SASI_Mm01_00069879 predicted 1280
9 SASI_Mm01_00069880 predicted 390
10 SASI_Mm02_00342984 predicted 983
11 SASI_Mm01_00069881 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013305
ST8SIA5 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-712s1c1
Sequence:CCGGGCACGAAATATTGGAAGTGAACTCGAGTTCACTTCCAATATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-1165s1c1
Sequence:CCGGCAGCATCATCACAGAGAGGTTCTCGAGAACCTCTCTGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-997s1c1
Sequence:CCGGCCAGTTTAAGAAGTGTGCTGTCTCGAGACAGCACACTTCTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-562s1c1
Sequence:CCGGGAGCCGAACTTTGCTCTTCATCTCGAGATGAAGAGCAAAGTTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-1510s1c1
Sequence:CCGGCCTCTACATCACTCACCACTACTCGAGTAGTGGTGAGTGATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013305.4-2177s21c1
Sequence:CCGGTATATCGAAGACTTAGCTATGCTCGAGCATAGCTAAGTCTTCGATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013305.4-687s21c1
Sequence:CCGGACTACATTAAGAGGTACTTTGCTCGAGCAAAGTACCTCTTAATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013305.4-947s21c1
Sequence:CCGGGGGACAAAGCTCAAGTATGAGCTCGAGCTCATACTTGAGCTTTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013305
ST8SIA5 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-712s1c1
Sequence:CCGGGCACGAAATATTGGAAGTGAACTCGAGTTCACTTCCAATATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-1165s1c1
Sequence:CCGGCAGCATCATCACAGAGAGGTTCTCGAGAACCTCTCTGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-997s1c1
Sequence:CCGGCCAGTTTAAGAAGTGTGCTGTCTCGAGACAGCACACTTCTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-562s1c1
Sequence:CCGGGAGCCGAACTTTGCTCTTCATCTCGAGATGAAGAGCAAAGTTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-1510s1c1
Sequence:CCGGCCTCTACATCACTCACCACTACTCGAGTAGTGGTGAGTGATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013305.4-2177s21c1
Sequence:CCGGTATATCGAAGACTTAGCTATGCTCGAGCATAGCTAAGTCTTCGATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013305.4-687s21c1
Sequence:CCGGACTACATTAAGAGGTACTTTGCTCGAGCAAAGTACCTCTTAATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013305.4-947s21c1
Sequence:CCGGGGGACAAAGCTCAAGTATGAGCTCGAGCTCATACTTGAGCTTTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013305
ST8SIA5 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-712s1c1
Sequence:CCGGGCACGAAATATTGGAAGTGAACTCGAGTTCACTTCCAATATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-1165s1c1
Sequence:CCGGCAGCATCATCACAGAGAGGTTCTCGAGAACCTCTCTGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-997s1c1
Sequence:CCGGCCAGTTTAAGAAGTGTGCTGTCTCGAGACAGCACACTTCTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-562s1c1
Sequence:CCGGGAGCCGAACTTTGCTCTTCATCTCGAGATGAAGAGCAAAGTTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013305.2-1510s1c1
Sequence:CCGGCCTCTACATCACTCACCACTACTCGAGTAGTGGTGAGTGATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013305.4-2177s21c1
Sequence:CCGGTATATCGAAGACTTAGCTATGCTCGAGCATAGCTAAGTCTTCGATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013305.4-687s21c1
Sequence:CCGGACTACATTAAGAGGTACTTTGCTCGAGCAAAGTACCTCTTAATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013305.4-947s21c1
Sequence:CCGGGGGACAAAGCTCAAGTATGAGCTCGAGCTCATACTTGAGCTTTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153124
ST8SIA5 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153124.1-1415s1c1
Sequence:CCGGCCTGAAGGATTCCTTGACCTTCTCGAGAAGGTCAAGGAATCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-1232s1c1
Sequence:CCGGCTTCTTCATCACGCACCATTACTCGAGTAATGGTGCGTGATGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-878s1c1
Sequence:CCGGCGTGAATCCCAGCATCATAATCTCGAGATTATGATGCTGGGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-506s1c1
Sequence:CCGGCCAGATATGCAAATGGGCAATCTCGAGATTGCCCATTTGCATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-284s1c1
Sequence:CCGGGAATCGAACTTTGCTCTTTATCTCGAGATAAAGAGCAAAGTTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153124
ST8SIA5 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153124.1-1415s1c1
Sequence:CCGGCCTGAAGGATTCCTTGACCTTCTCGAGAAGGTCAAGGAATCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-1232s1c1
Sequence:CCGGCTTCTTCATCACGCACCATTACTCGAGTAATGGTGCGTGATGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-878s1c1
Sequence:CCGGCGTGAATCCCAGCATCATAATCTCGAGATTATGATGCTGGGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-506s1c1
Sequence:CCGGCCAGATATGCAAATGGGCAATCTCGAGATTGCCCATTTGCATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-284s1c1
Sequence:CCGGGAATCGAACTTTGCTCTTTATCTCGAGATAAAGAGCAAAGTTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153124
ST8SIA5 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153124.1-1415s1c1
Sequence:CCGGCCTGAAGGATTCCTTGACCTTCTCGAGAAGGTCAAGGAATCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-1232s1c1
Sequence:CCGGCTTCTTCATCACGCACCATTACTCGAGTAATGGTGCGTGATGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-878s1c1
Sequence:CCGGCGTGAATCCCAGCATCATAATCTCGAGATTATGATGCTGGGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-506s1c1
Sequence:CCGGCCAGATATGCAAATGGGCAATCTCGAGATTGCCCATTTGCATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153124.1-284s1c1
Sequence:CCGGGAATCGAACTTTGCTCTTTATCTCGAGATAAAGAGCAAAGTTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks