EMAIL THIS PAGE TO A FRIEND

ST8SIA6

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6

Synonyms: SIA8F SIAT8F ST8SIA-VI
UniProtKB ID: P61647, B0YJ97, B9EH72, Q5VZH4
Gene ID:
Human(338596) Summary: Sialic acid is a key determinate of oligosaccharide structures involved in cell-cell communication, cell-substrate interaction, adhesion, and protein targeting. ST8SIA6 belongs to a family of sialyltransferases (EC 2.4.99.8) that synthesize sialylglycoconjugates (Takashima et al., 2002 [PubMed 11980897]
Mouse(241230) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Rat(291325) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
naked mole-rat(101718622) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Domestic Rabbit(100348505) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
domestic guinea pig(100724433) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
cow(494116) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
sheep(101118466) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Zebrafish(553212) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Horse(100056051) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
domestic cat(101100974) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
dog(487115) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
chicken(414335) ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_291725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004470 Rosetta Predictions human pricing
NM_213624 Rosetta Predictions rat pricing
NM_145838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195143 predicted 288
2 SASI_Hs01_00195144 predicted 950
3 SASI_Hs01_00195145 predicted 1059
4 SASI_Hs01_00195146 predicted 1107
5 SASI_Hs01_00195147 predicted 1131
6 SASI_Hs02_00304608 predicted 1132
7 SASI_Hs01_00195148 predicted 439
8 SASI_Hs01_00195149 predicted 387
9 SASI_Hs01_00195150 predicted 1140
10 SASI_Hs01_00195151 predicted 293
11 SASI_Hs01_00195152 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077348 predicted 660
2 SASI_Rn01_00077349 predicted 652
3 SASI_Rn01_00077350 predicted 713
4 SASI_Rn01_00077351 predicted 245
5 SASI_Rn01_00077352 predicted 286
6 SASI_Rn01_00077353 predicted 862
7 SASI_Rn01_00077354 predicted 226
8 SASI_Rn01_00077355 predicted 846
9 SASI_Rn02_00270615 predicted 301
10 SASI_Rn01_00077356 predicted 694
11 SASI_Rn01_00077357 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185572 predicted 1201
2 SASI_Mm01_00185573 predicted 925
3 SASI_Mm01_00185574 predicted 1213
4 SASI_Mm01_00185575 predicted 1184
5 SASI_Mm01_00185576 predicted 319
6 SASI_Mm01_00185577 predicted 306
7 SASI_Mm01_00185578 predicted 742
8 SASI_Mm02_00341319 predicted 786
9 SASI_Mm02_00341320 predicted 292
10 SASI_Mm01_00185579 predicted 1235
11 SASI_Mm01_00185580 predicted 1105
12 SASI_Mm01_00185581 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004470
ST8SIA6 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000436740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004470.1-221s21c1
Sequence:CCGGCGCTCCAACTGACGGAGAAATCTCGAGATTTCTCCGTCAGTTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004470.1-435s21c1
Sequence:CCGGCACTCCAGTTGGGACTAATATCTCGAGATATTAGTCCCAACTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004470
ST8SIA6 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000436740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004470.1-221s21c1
Sequence:CCGGCGCTCCAACTGACGGAGAAATCTCGAGATTTCTCCGTCAGTTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004470.1-435s21c1
Sequence:CCGGCACTCCAGTTGGGACTAATATCTCGAGATATTAGTCCCAACTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004470
ST8SIA6 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000436740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004470.1-221s21c1
Sequence:CCGGCGCTCCAACTGACGGAGAAATCTCGAGATTTCTCCGTCAGTTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004470.1-435s21c1
Sequence:CCGGCACTCCAGTTGGGACTAATATCTCGAGATATTAGTCCCAACTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145838
ST8SIA6 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145838.1-1350s1c1
Sequence:CCGGGCACAGAGAAAGCATGAATTACTCGAGTAATTCATGCTTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-928s1c1
Sequence:CCGGCCAAACACTCAAAGAGTCAAACTCGAGTTTGACTCTTTGAGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-388s1c1
Sequence:CCGGCCAGACCATCACAAACATACACTCGAGTGTATGTTTGTGATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-479s1c1
Sequence:CCGGGCCATTCAAGACTTCGTGGTTCTCGAGAACCACGAAGTCTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-1109s1c1
Sequence:CCGGCCTTTCTCTAAGACTATCGAACTCGAGTTCGATAGTCTTAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145838
ST8SIA6 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145838.1-1350s1c1
Sequence:CCGGGCACAGAGAAAGCATGAATTACTCGAGTAATTCATGCTTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-928s1c1
Sequence:CCGGCCAAACACTCAAAGAGTCAAACTCGAGTTTGACTCTTTGAGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-388s1c1
Sequence:CCGGCCAGACCATCACAAACATACACTCGAGTGTATGTTTGTGATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-479s1c1
Sequence:CCGGGCCATTCAAGACTTCGTGGTTCTCGAGAACCACGAAGTCTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-1109s1c1
Sequence:CCGGCCTTTCTCTAAGACTATCGAACTCGAGTTCGATAGTCTTAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145838
ST8SIA6 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145838.1-1350s1c1
Sequence:CCGGGCACAGAGAAAGCATGAATTACTCGAGTAATTCATGCTTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-928s1c1
Sequence:CCGGCCAAACACTCAAAGAGTCAAACTCGAGTTTGACTCTTTGAGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-388s1c1
Sequence:CCGGCCAGACCATCACAAACATACACTCGAGTGTATGTTTGTGATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-479s1c1
Sequence:CCGGGCCATTCAAGACTTCGTGGTTCTCGAGAACCACGAAGTCTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145838.1-1109s1c1
Sequence:CCGGCCTTTCTCTAAGACTATCGAACTCGAGTTCGATAGTCTTAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291725
ST8SIA6 MISSION shRNA Bacterial Glycerol Stock
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-943s1c1
Sequence:CCGGGCCCTATTTCTGGAGGACATTCTCGAGAATGTCCTCCAGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-376s1c1
Sequence:CCGGCGCGCCACTAACAGCACATATCTCGAGATATGTGCTGTTAGTGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-1046s1c1
Sequence:CCGGCGCTCGAAGAGTCTAAAGCAACTCGAGTTGCTTTAGACTCTTCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-581s1c1
Sequence:CCGGCCTGCTGTGATGCTGTTCAAACTCGAGTTTGAACAGCATCACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-898s1c1
Sequence:CCGGCCAAGCATCATAACTCTGAAACTCGAGTTTCAGAGTTATGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291725
ST8SIA6 MISSION shRNA shRNA Plasmid DNA
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-943s1c1
Sequence:CCGGGCCCTATTTCTGGAGGACATTCTCGAGAATGTCCTCCAGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-376s1c1
Sequence:CCGGCGCGCCACTAACAGCACATATCTCGAGATATGTGCTGTTAGTGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-1046s1c1
Sequence:CCGGCGCTCGAAGAGTCTAAAGCAACTCGAGTTGCTTTAGACTCTTCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-581s1c1
Sequence:CCGGCCTGCTGTGATGCTGTTCAAACTCGAGTTTGAACAGCATCACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-898s1c1
Sequence:CCGGCCAAGCATCATAACTCTGAAACTCGAGTTTCAGAGTTATGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291725
ST8SIA6 MISSION shRNA Lentiviral Transduction Particles
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-943s1c1
Sequence:CCGGGCCCTATTTCTGGAGGACATTCTCGAGAATGTCCTCCAGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-376s1c1
Sequence:CCGGCGCGCCACTAACAGCACATATCTCGAGATATGTGCTGTTAGTGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-1046s1c1
Sequence:CCGGCGCTCGAAGAGTCTAAAGCAACTCGAGTTGCTTTAGACTCTTCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-581s1c1
Sequence:CCGGCCTGCTGTGATGCTGTTCAAACTCGAGTTTGAACAGCATCACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291725.3-898s1c1
Sequence:CCGGCCAAGCATCATAACTCTGAAACTCGAGTTTCAGAGTTATGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks