EMAIL THIS PAGE TO A FRIEND

STAB1

stabilin 1

Synonyms: CLEVER-1 FEEL-1 FELE-1 FEX1 STAB-1
UniProtKB ID: Q9NY15, A7E297, Q8IUH0, Q8IUH1, Q93072
Gene ID:
Human(23166) Summary: This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
Mouse(192187) stabilin 1
Rat(100363145) stabilin 1
Zebrafish(570626) stabilin 1
Horse(100060121) stabilin 1
dog(484735) stabilin 1
chicken(415894) stabilin 1
cow(505543) stabilin 1
sheep(101111323) stabilin 1
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015136 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013361 MISSION® esiRNA esiRNA targeting mouse Stab1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015136 Rosetta Predictions human pricing
NM_138672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150158 predicted 1434
2 SASI_Hs01_00150159 predicted 1513
3 SASI_Hs01_00150160 predicted 1373
4 SASI_Hs01_00150161 predicted 7371
5 SASI_Hs01_00150162 predicted 1414
6 SASI_Hs01_00150163 predicted 7388
7 SASI_Hs01_00150164 predicted 4839
8 SASI_Hs01_00150165 predicted 6401
9 SASI_Hs01_00150166 predicted 7145
10 SASI_Hs01_00150167 predicted 5830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182520 predicted 287
2 SASI_Mm01_00182521 predicted 2238
3 SASI_Mm01_00182522 predicted 1053
4 SASI_Mm01_00182523 predicted 1580
5 SASI_Mm01_00182524 predicted 6122
6 SASI_Mm01_00182525 predicted 4035
7 SASI_Mm01_00182527 predicted 6621
8 SASI_Mm01_00182529 predicted 5904
9 SASI_Mm02_00339741 predicted 2450
10 SASI_Mm02_00339742 predicted 384
11 SASI_Mm01_00182526 predicted 6157
12 SASI_Mm01_00182528 predicted 4952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138672
STAB1 MISSION shRNA Bacterial Glycerol Stock
stabilin 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.1-4916s1c1
Sequence:CCGGCGGACCTTTCACTGTCTTTGTCTCGAGACAAAGACAGTGAAAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-3285s1c1
Sequence:CCGGCGGTTAAATGGTCAACAAGTACTCGAGTACTTGTTGACCATTTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.1-2156s1c1
Sequence:CCGGCGTTTATATCCACGACCCAAACTCGAGTTTGGGTCGTGGATATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-5119s1c1
Sequence:CCGGGCAGCATTTATCTCAATGATTCTCGAGAATCATTGAGATAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-7260s1c1
Sequence:CCGGGCCACCTTTCTGAGTATCAATCTCGAGATTGATACTCAGAAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-5540s1c1
Sequence:CCGGGCACGGAAACACCATCTCTTTCTCGAGAAAGAGATGGTGTTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.2-3107s1c1
Sequence:CCGGCAGTTGCTATGGAGATATTATCTCGAGATAATATCTCCATAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138672
STAB1 MISSION shRNA shRNA Plasmid DNA
stabilin 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.1-4916s1c1
Sequence:CCGGCGGACCTTTCACTGTCTTTGTCTCGAGACAAAGACAGTGAAAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-3285s1c1
Sequence:CCGGCGGTTAAATGGTCAACAAGTACTCGAGTACTTGTTGACCATTTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.1-2156s1c1
Sequence:CCGGCGTTTATATCCACGACCCAAACTCGAGTTTGGGTCGTGGATATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-5119s1c1
Sequence:CCGGGCAGCATTTATCTCAATGATTCTCGAGAATCATTGAGATAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-7260s1c1
Sequence:CCGGGCCACCTTTCTGAGTATCAATCTCGAGATTGATACTCAGAAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-5540s1c1
Sequence:CCGGGCACGGAAACACCATCTCTTTCTCGAGAAAGAGATGGTGTTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.2-3107s1c1
Sequence:CCGGCAGTTGCTATGGAGATATTATCTCGAGATAATATCTCCATAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138672
STAB1 MISSION shRNA Lentiviral Transduction Particles
stabilin 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.1-4916s1c1
Sequence:CCGGCGGACCTTTCACTGTCTTTGTCTCGAGACAAAGACAGTGAAAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-3285s1c1
Sequence:CCGGCGGTTAAATGGTCAACAAGTACTCGAGTACTTGTTGACCATTTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.1-2156s1c1
Sequence:CCGGCGTTTATATCCACGACCCAAACTCGAGTTTGGGTCGTGGATATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-5119s1c1
Sequence:CCGGGCAGCATTTATCTCAATGATTCTCGAGAATCATTGAGATAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-7260s1c1
Sequence:CCGGGCCACCTTTCTGAGTATCAATCTCGAGATTGATACTCAGAAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138672.1-5540s1c1
Sequence:CCGGGCACGGAAACACCATCTCTTTCTCGAGAAAGAGATGGTGTTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138672.2-3107s1c1
Sequence:CCGGCAGTTGCTATGGAGATATTATCTCGAGATAATATCTCCATAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015136
STAB1 MISSION shRNA Bacterial Glycerol Stock
stabilin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-5421s1c1
Sequence:CCGGCCACATGATTCGCAATGTCGACTCGAGTCGACATTGCGAATCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-4836s1c1
Sequence:CCGGCCTGGAATATAAGGAGCTCAACTCGAGTTGAGCTCCTTATATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-7116s1c1
Sequence:CCGGGCTCACGTATAAGACACTCTTCTCGAGAAGAGTGTCTTATACGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-885s1c1
Sequence:CCGGCAACTCTACTTTGTGTGTGTACTCGAGTACACACACAAAGTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-1440s1c1
Sequence:CCGGGCAGACGTTCAACATCTACAACTCGAGTTGTAGATGTTGAACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-109s1c1
Sequence:CCGGGTGCTGTTCAAAGGCTGTGATCTCGAGATCACAGCCTTTGAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-3831s1c1
Sequence:CCGGCCTGCGGGAGAAATGTGTAAACTCGAGTTTACACATTTCTCCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-3275s1c1
Sequence:CCGGGCTGGGAGATTCGCAACATTACTCGAGTAATGTTGCGAATCTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-7138s1c1
Sequence:CCGGGTCCCTGTCAATGAAGGCTTTCTCGAGAAAGCCTTCATTGACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015136
STAB1 MISSION shRNA shRNA Plasmid DNA
stabilin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-5421s1c1
Sequence:CCGGCCACATGATTCGCAATGTCGACTCGAGTCGACATTGCGAATCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-4836s1c1
Sequence:CCGGCCTGGAATATAAGGAGCTCAACTCGAGTTGAGCTCCTTATATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-7116s1c1
Sequence:CCGGGCTCACGTATAAGACACTCTTCTCGAGAAGAGTGTCTTATACGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-885s1c1
Sequence:CCGGCAACTCTACTTTGTGTGTGTACTCGAGTACACACACAAAGTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-1440s1c1
Sequence:CCGGGCAGACGTTCAACATCTACAACTCGAGTTGTAGATGTTGAACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-109s1c1
Sequence:CCGGGTGCTGTTCAAAGGCTGTGATCTCGAGATCACAGCCTTTGAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-3831s1c1
Sequence:CCGGCCTGCGGGAGAAATGTGTAAACTCGAGTTTACACATTTCTCCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-3275s1c1
Sequence:CCGGGCTGGGAGATTCGCAACATTACTCGAGTAATGTTGCGAATCTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-7138s1c1
Sequence:CCGGGTCCCTGTCAATGAAGGCTTTCTCGAGAAAGCCTTCATTGACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015136
STAB1 MISSION shRNA Lentiviral Transduction Particles
stabilin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-5421s1c1
Sequence:CCGGCCACATGATTCGCAATGTCGACTCGAGTCGACATTGCGAATCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-4836s1c1
Sequence:CCGGCCTGGAATATAAGGAGCTCAACTCGAGTTGAGCTCCTTATATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-7116s1c1
Sequence:CCGGGCTCACGTATAAGACACTCTTCTCGAGAAGAGTGTCTTATACGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-885s1c1
Sequence:CCGGCAACTCTACTTTGTGTGTGTACTCGAGTACACACACAAAGTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-1440s1c1
Sequence:CCGGGCAGACGTTCAACATCTACAACTCGAGTTGTAGATGTTGAACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-109s1c1
Sequence:CCGGGTGCTGTTCAAAGGCTGTGATCTCGAGATCACAGCCTTTGAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-3831s1c1
Sequence:CCGGCCTGCGGGAGAAATGTGTAAACTCGAGTTTACACATTTCTCCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-3275s1c1
Sequence:CCGGGCTGGGAGATTCGCAACATTACTCGAGTAATGTTGCGAATCTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015136.1-7138s1c1
Sequence:CCGGGTCCCTGTCAATGAAGGCTTTCTCGAGAAAGCCTTCATTGACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks