EMAIL THIS PAGE TO A FRIEND

STAB2

stabilin 2

Synonyms: FEEL2 FELE-2 FELL2 FEX2 HARE
Gene ID:
Human(55576) Summary: This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
Mouse(192188) stabilin 2
Rat(282580) stabilin 2
cow(407177) stabilin 2
sheep(101111181) stabilin 2
Zebrafish(565194) stabilin 2
chicken(418089) stabilin 2
Horse(100067500) stabilin 2
dog(100687903) stabilin 2
Gene Class: Cytoskeleton
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026871 Anti-STAB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075121 MISSION® esiRNA esiRNA targeting mouse Stab2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017564 Rosetta Predictions human pricing
XM_238531 Rosetta Predictions rat pricing
NM_138673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148976 predicted 2444
2 SASI_Hs01_00148977 predicted 5371
3 SASI_Hs01_00148978 predicted 6329
4 SASI_Hs01_00148979 predicted 1357
5 SASI_Hs01_00148982 predicted 6193
6 SASI_Hs02_00350218 predicted 7153
7 SASI_Hs01_00148984 predicted 5242
8 SASI_Hs02_00350219 predicted 4938
9 SASI_Hs02_00350220 predicted 336
10 SASI_Hs02_00350221 predicted 390
11 SASI_Hs01_00148975 predicted 266
12 SASI_Hs01_00148980 predicted 4533
13 SASI_Hs01_00148981 predicted 814
14 SASI_Hs01_00148983 predicted 5437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391386 predicted 208
2 SASI_Rn02_00391387 predicted 691
3 SASI_Rn02_00391388 predicted 1119
4 SASI_Rn02_00391389 predicted 1408
5 SASI_Rn02_00391390 predicted 955
6 SASI_Rn02_00391391 predicted 1235
7 SASI_Rn02_00391392 predicted 351
8 SASI_Rn02_00391393 predicted 1193
9 SASI_Rn02_00391394 predicted 223
10 SASI_Rn02_00391395 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126967 predicted 3477
2 SASI_Mm01_00126968 predicted 5527
3 SASI_Mm01_00126969 predicted 881
4 SASI_Mm01_00126970 predicted 2864
5 SASI_Mm02_00339743 predicted 5646
6 SASI_Mm02_00339744 predicted 3543
7 SASI_Mm01_00126971 predicted 6603
8 SASI_Mm01_00126974 predicted 7211
9 SASI_Mm02_00339745 predicted 4248
10 SASI_Mm01_00126975 predicted 253
11 SASI_Mm01_00126972 predicted 1002
12 SASI_Mm01_00126973 predicted 3794
13 SASI_Mm01_00126976 predicted 6499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017564
STAB2 MISSION shRNA Bacterial Glycerol Stock
stabilin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-5119s1c1
Sequence:CCGGCGGGTTAAAGACTGGGACAAACTCGAGTTTGTCCCAGTCTTTAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-4719s1c1
Sequence:CCGGCCTGGAAATCAACCCGTGTTTCTCGAGAAACACGGGTTGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-6383s1c1
Sequence:CCGGCGTGTGAGTGTAACCTGGATTCTCGAGAATCCAGGTTACACTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-349s1c1
Sequence:CCGGCCGGATGGTTACACCATGATTCTCGAGAATCATGGTGTAACCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-3056s1c1
Sequence:CCGGGCTTGGAACAAACCGGGAAATCTCGAGATTTCCCGGTTTGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-7621s1c1
Sequence:CCGGGCTTACTCCTACTTTCGGATACTCGAGTATCCGAAAGTAGGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-3916s1c1
Sequence:CCGGGCTCCAATAAACTACACCAATCTCGAGATTGGTGTAGTTTATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-7029s1c1
Sequence:CCGGGAGTGAAATGTGGGATGTCTTCTCGAGAAGACATCCCACATTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017564
STAB2 MISSION shRNA shRNA Plasmid DNA
stabilin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-5119s1c1
Sequence:CCGGCGGGTTAAAGACTGGGACAAACTCGAGTTTGTCCCAGTCTTTAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-4719s1c1
Sequence:CCGGCCTGGAAATCAACCCGTGTTTCTCGAGAAACACGGGTTGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-6383s1c1
Sequence:CCGGCGTGTGAGTGTAACCTGGATTCTCGAGAATCCAGGTTACACTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-349s1c1
Sequence:CCGGCCGGATGGTTACACCATGATTCTCGAGAATCATGGTGTAACCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-3056s1c1
Sequence:CCGGGCTTGGAACAAACCGGGAAATCTCGAGATTTCCCGGTTTGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-7621s1c1
Sequence:CCGGGCTTACTCCTACTTTCGGATACTCGAGTATCCGAAAGTAGGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-3916s1c1
Sequence:CCGGGCTCCAATAAACTACACCAATCTCGAGATTGGTGTAGTTTATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-7029s1c1
Sequence:CCGGGAGTGAAATGTGGGATGTCTTCTCGAGAAGACATCCCACATTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017564
STAB2 MISSION shRNA Lentiviral Transduction Particles
stabilin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-5119s1c1
Sequence:CCGGCGGGTTAAAGACTGGGACAAACTCGAGTTTGTCCCAGTCTTTAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-4719s1c1
Sequence:CCGGCCTGGAAATCAACCCGTGTTTCTCGAGAAACACGGGTTGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-6383s1c1
Sequence:CCGGCGTGTGAGTGTAACCTGGATTCTCGAGAATCCAGGTTACACTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-349s1c1
Sequence:CCGGCCGGATGGTTACACCATGATTCTCGAGAATCATGGTGTAACCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-3056s1c1
Sequence:CCGGGCTTGGAACAAACCGGGAAATCTCGAGATTTCCCGGTTTGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-7621s1c1
Sequence:CCGGGCTTACTCCTACTTTCGGATACTCGAGTATCCGAAAGTAGGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017564.8-3916s1c1
Sequence:CCGGGCTCCAATAAACTACACCAATCTCGAGATTGGTGTAGTTTATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017564.8-7029s1c1
Sequence:CCGGGAGTGAAATGTGGGATGTCTTCTCGAGAAGACATCCCACATTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138673
STAB2 MISSION shRNA Bacterial Glycerol Stock
stabilin 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000109510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138673.1-7844s1c1
Sequence:CCGGGTATGATAACTCAGAAGCCATCTCGAGATGGCTTCTGAGTTATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-6331s1c1
Sequence:CCGGCGTGGATTTCTGCAAACAGAACTCGAGTTCTGTTTGCAGAAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-1075s1c1
Sequence:CCGGCCCATGTCATAAGAATGCGAACTCGAGTTCGCATTCTTATGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-3815s1c1
Sequence:CCGGGCTCCAATAAACTACACCAATCTCGAGATTGGTGTAGTTTATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138673
STAB2 MISSION shRNA shRNA Plasmid DNA
stabilin 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000109510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138673.1-7844s1c1
Sequence:CCGGGTATGATAACTCAGAAGCCATCTCGAGATGGCTTCTGAGTTATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-6331s1c1
Sequence:CCGGCGTGGATTTCTGCAAACAGAACTCGAGTTCTGTTTGCAGAAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-1075s1c1
Sequence:CCGGCCCATGTCATAAGAATGCGAACTCGAGTTCGCATTCTTATGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-3815s1c1
Sequence:CCGGGCTCCAATAAACTACACCAATCTCGAGATTGGTGTAGTTTATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138673
STAB2 MISSION shRNA Lentiviral Transduction Particles
stabilin 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000109510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138673.1-7844s1c1
Sequence:CCGGGTATGATAACTCAGAAGCCATCTCGAGATGGCTTCTGAGTTATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-6331s1c1
Sequence:CCGGCGTGGATTTCTGCAAACAGAACTCGAGTTCTGTTTGCAGAAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-1075s1c1
Sequence:CCGGCCCATGTCATAAGAATGCGAACTCGAGTTCGCATTCTTATGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138673.1-3815s1c1
Sequence:CCGGGCTCCAATAAACTACACCAATCTCGAGATTGGTGTAGTTTATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks