EMAIL THIS PAGE TO A FRIEND

STAC2

SH3 and cysteine rich domain 2

Synonyms: 24b2 24b2/STAC2
UniProtKB ID: Q6ZMT1, Q32MA3
Gene ID:
Mouse(217154) SH3 and cysteine rich domain 2
Rat(363674) SH3 and cysteine rich domain 2
naked mole-rat(101713404) SH3 and cysteine rich domain 2
domestic guinea pig(100722066) SH3 and cysteine rich domain 2
cow(536456) SH3 and cysteine rich domain 2
sheep(101103080) SH3 and cysteine rich domain 2
dog(491029) SH3 and cysteine rich domain 2
Horse(100068363) SH3 and cysteine rich domain 2
domestic cat(101089476) SH3 and cysteine rich domain 2
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198993 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198993 Rosetta Predictions human pricing
NM_001108834 Rosetta Predictions rat pricing
NM_146028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184542 predicted 1908
2 SASI_Hs01_00184543 predicted 861
3 SASI_Hs01_00184544 predicted 1638
4 SASI_Hs01_00184545 predicted 1096
5 SASI_Hs01_00184546 predicted 1089
6 SASI_Hs01_00184547 predicted 766
7 SASI_Hs01_00184548 predicted 1467
8 SASI_Hs01_00184549 predicted 1324
9 SASI_Hs01_00184550 predicted 979
10 SASI_Hs02_00372506 predicted 1638
11 SASI_Hs01_00184551 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242535 predicted 1639
2 SASI_Rn02_00242536 predicted 573
3 SASI_Rn02_00242537 predicted 611
4 SASI_Rn02_00242538 predicted 1164
5 SASI_Rn02_00242539 predicted 1370
6 SASI_Rn02_00242540 predicted 1515
7 SASI_Rn02_00242541 predicted 1126
8 SASI_Rn02_00242542 predicted 1338
9 SASI_Rn02_00242543 predicted 629
10 SASI_Rn02_00242544 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068524 predicted 572
2 SASI_Mm02_00341614 predicted 477
3 SASI_Mm01_00068525 predicted 612
4 SASI_Mm01_00068527 predicted 898
5 SASI_Mm01_00068528 predicted 609
6 SASI_Mm01_00068529 predicted 1525
7 SASI_Mm01_00068530 predicted 1571
8 SASI_Mm01_00068532 predicted 612
9 SASI_Mm01_00068533 predicted 1491
10 SASI_Mm02_00341615 predicted 1447
11 SASI_Mm01_00068526 predicted 1710
12 SASI_Mm01_00068531 predicted 1560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146028
STAC2 MISSION shRNA Bacterial Glycerol Stock
SH3 and cysteine rich domain 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146028.4-1183s21c1
Sequence:CCGGGAGCGTGACGAGCTAACAGAACTCGAGTTCTGTTAGCTCGTCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146028.4-1429s21c1
Sequence:CCGGATGCTGGTGGATGACTCTAACCTCGAGGTTAGAGTCATCCACCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146028.4-2178s21c1
Sequence:CCGGTATGGGAGAGCCCTAAGTTAACTCGAGTTAACTTAGGGCTCTCCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146028.2-2645s1c1
Sequence:CCGGCCACCATCAAATGATGCTCTACTCGAGTAGAGCATCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-563s1c1
Sequence:CCGGGAAACCAAGCTCCAGCGATTTCTCGAGAAATCGCTGGAGCTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-1524s1c1
Sequence:CCGGCAGGAGAGAATGTTTGGCGATCTCGAGATCGCCAAACATTCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-613s1c1
Sequence:CCGGTCGAAGTAAGAGCGTAGAGAACTCGAGTTCTCTACGCTCTTACTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-610s1c1
Sequence:CCGGCCTTCGAAGTAAGAGCGTAGACTCGAGTCTACGCTCTTACTTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146028
STAC2 MISSION shRNA shRNA Plasmid DNA
SH3 and cysteine rich domain 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146028.4-1183s21c1
Sequence:CCGGGAGCGTGACGAGCTAACAGAACTCGAGTTCTGTTAGCTCGTCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146028.4-1429s21c1
Sequence:CCGGATGCTGGTGGATGACTCTAACCTCGAGGTTAGAGTCATCCACCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146028.4-2178s21c1
Sequence:CCGGTATGGGAGAGCCCTAAGTTAACTCGAGTTAACTTAGGGCTCTCCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146028.2-2645s1c1
Sequence:CCGGCCACCATCAAATGATGCTCTACTCGAGTAGAGCATCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-563s1c1
Sequence:CCGGGAAACCAAGCTCCAGCGATTTCTCGAGAAATCGCTGGAGCTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-1524s1c1
Sequence:CCGGCAGGAGAGAATGTTTGGCGATCTCGAGATCGCCAAACATTCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-613s1c1
Sequence:CCGGTCGAAGTAAGAGCGTAGAGAACTCGAGTTCTCTACGCTCTTACTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-610s1c1
Sequence:CCGGCCTTCGAAGTAAGAGCGTAGACTCGAGTCTACGCTCTTACTTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146028
STAC2 MISSION shRNA Lentiviral Transduction Particles
SH3 and cysteine rich domain 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146028.4-1183s21c1
Sequence:CCGGGAGCGTGACGAGCTAACAGAACTCGAGTTCTGTTAGCTCGTCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146028.4-1429s21c1
Sequence:CCGGATGCTGGTGGATGACTCTAACCTCGAGGTTAGAGTCATCCACCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146028.4-2178s21c1
Sequence:CCGGTATGGGAGAGCCCTAAGTTAACTCGAGTTAACTTAGGGCTCTCCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146028.2-2645s1c1
Sequence:CCGGCCACCATCAAATGATGCTCTACTCGAGTAGAGCATCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-563s1c1
Sequence:CCGGGAAACCAAGCTCCAGCGATTTCTCGAGAAATCGCTGGAGCTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-1524s1c1
Sequence:CCGGCAGGAGAGAATGTTTGGCGATCTCGAGATCGCCAAACATTCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-613s1c1
Sequence:CCGGTCGAAGTAAGAGCGTAGAGAACTCGAGTTCTCTACGCTCTTACTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146028.2-610s1c1
Sequence:CCGGCCTTCGAAGTAAGAGCGTAGACTCGAGTCTACGCTCTTACTTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198993
STAC2 MISSION shRNA Bacterial Glycerol Stock
SH3 and cysteine rich domain 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-865s21c1
Sequence:CCGGCTGATGAACCGCTCCAGTTTCCTCGAGGAAACTGGAGCGGTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198993.2-2013s21c1
Sequence:CCGGACCTCTGTCATTCCGTCAATTCTCGAGAATTGACGGAATGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-1233s21c1
Sequence:CCGGTGGCTTCTTCCCAGCTAATTTCTCGAGAAATTAGCTGGGAAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-985s21c1
Sequence:CCGGGACAGTGCATCTCCAGTATTCCTCGAGGAATACTGGAGATGCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198993.1-632s1c1
Sequence:CCGGCTTGCGATGTAAGATGTGCAACTCGAGTTGCACATCTTACATCGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198993.1-1105s1c1
Sequence:CCGGCCTACGTTGCACTCTACAAGTCTCGAGACTTGTAGAGTGCAACGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198993
STAC2 MISSION shRNA shRNA Plasmid DNA
SH3 and cysteine rich domain 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-865s21c1
Sequence:CCGGCTGATGAACCGCTCCAGTTTCCTCGAGGAAACTGGAGCGGTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198993.2-2013s21c1
Sequence:CCGGACCTCTGTCATTCCGTCAATTCTCGAGAATTGACGGAATGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-1233s21c1
Sequence:CCGGTGGCTTCTTCCCAGCTAATTTCTCGAGAAATTAGCTGGGAAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-985s21c1
Sequence:CCGGGACAGTGCATCTCCAGTATTCCTCGAGGAATACTGGAGATGCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198993.1-632s1c1
Sequence:CCGGCTTGCGATGTAAGATGTGCAACTCGAGTTGCACATCTTACATCGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198993.1-1105s1c1
Sequence:CCGGCCTACGTTGCACTCTACAAGTCTCGAGACTTGTAGAGTGCAACGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198993
STAC2 MISSION shRNA Lentiviral Transduction Particles
SH3 and cysteine rich domain 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-865s21c1
Sequence:CCGGCTGATGAACCGCTCCAGTTTCCTCGAGGAAACTGGAGCGGTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198993.2-2013s21c1
Sequence:CCGGACCTCTGTCATTCCGTCAATTCTCGAGAATTGACGGAATGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-1233s21c1
Sequence:CCGGTGGCTTCTTCCCAGCTAATTTCTCGAGAAATTAGCTGGGAAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198993.2-985s21c1
Sequence:CCGGGACAGTGCATCTCCAGTATTCCTCGAGGAATACTGGAGATGCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198993.1-632s1c1
Sequence:CCGGCTTGCGATGTAAGATGTGCAACTCGAGTTGCACATCTTACATCGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198993.1-1105s1c1
Sequence:CCGGCCTACGTTGCACTCTACAAGTCTCGAGACTTGTAGAGTGCAACGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks