EMAIL THIS PAGE TO A FRIEND

STAC3

SH3 and cysteine rich domain 3

UniProtKB ID: Q96MF2, Q96HU5
Gene ID:
Mouse(237611) SH3 and cysteine rich domain 3
Rat(362895) SH3 and cysteine rich domain 3
Zebrafish(445111) SH3 and cysteine rich domain 3
dog(481125) SH3 and cysteine rich domain 3
Horse(100050186) SH3 and cysteine rich domain 3
domestic cat(101081561) SH3 and cysteine rich domain 3
cow(518234) SH3 and cysteine rich domain 3
sheep(101123024) SH3 and cysteine rich domain 3
domestic guinea pig(100725409) SH3 and cysteine rich domain 3
naked mole-rat(101720733) SH3 and cysteine rich domain 3
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006531 MISSION® esiRNA esiRNA targeting human STAC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145064 Rosetta Predictions human pricing
NM_001130558 Rosetta Predictions rat pricing
NM_177707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212720 predicted 705
2 SASI_Hs01_00212721 predicted 653
3 SASI_Hs01_00212722 predicted 663
4 SASI_Hs01_00212723 predicted 670
5 SASI_Hs02_00364968 predicted 920
6 SASI_Hs01_00212725 predicted 707
7 SASI_Hs01_00212726 predicted 692
8 SASI_Hs01_00212727 predicted 693
9 SASI_Hs01_00212728 predicted 1248
10 SASI_Hs01_00212729 predicted 1149
11 SASI_Hs01_00212724 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255749 predicted 988
2 SASI_Rn02_00255750 predicted 633
3 SASI_Rn02_00255751 predicted 313
4 SASI_Rn02_00255752 predicted 595
5 SASI_Rn02_00255753 predicted 373
6 SASI_Rn02_00255754 predicted 870
7 SASI_Rn02_00255755 predicted 312
8 SASI_Rn02_00255756 predicted 606
9 SASI_Rn02_00255757 predicted 1003
10 SASI_Rn02_00255758 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040171 predicted 1221
2 SASI_Mm01_00040172 predicted 1423
3 SASI_Mm01_00040173 predicted 993
4 SASI_Mm01_00040174 predicted 801
5 SASI_Mm01_00040175 predicted 826
6 SASI_Mm01_00040176 predicted 1096
7 SASI_Mm01_00040177 predicted 1238
8 SASI_Mm01_00040178 predicted 1084
9 SASI_Mm01_00040179 predicted 1036
10 SASI_Mm01_00040180 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145064
STAC3 MISSION shRNA Bacterial Glycerol Stock
SH3 and cysteine rich domain 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-436s1c1
Sequence:CCGGCCTCCTAAGCTGGTCAACGATCTCGAGATCGTTGACCAGCTTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-889s1c1
Sequence:CCGGGCTGAGAAGAAGACACCTGATCTCGAGATCAGGTGTCTTCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-1005s1c1
Sequence:CCGGAGGAGAGAAGATCACAGTCATCTCGAGATGACTGTGATCTTCTCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-952s1c1
Sequence:CCGGGTGGCTCTCTATCGGTTCAAACTCGAGTTTGAACCGATAGAGAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-593s1c1
Sequence:CCGGCCTATGTGGAAATGCAGAGATCTCGAGATCTCTGCATTTCCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-506s21c1
Sequence:CCGGATGTCTGTGCCCGGATGATTGCTCGAGCAATCATCCGGGCACAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-674s21c1
Sequence:CCGGAGCAGTACGCTTGTGTCAAAGCTCGAGCTTTGACACAAGCGTACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-927s21c1
Sequence:CCGGTGGCTTCCAGCAGTCTCATTACTCGAGTAATGAGACTGCTGGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145064
STAC3 MISSION shRNA shRNA Plasmid DNA
SH3 and cysteine rich domain 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-436s1c1
Sequence:CCGGCCTCCTAAGCTGGTCAACGATCTCGAGATCGTTGACCAGCTTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-889s1c1
Sequence:CCGGGCTGAGAAGAAGACACCTGATCTCGAGATCAGGTGTCTTCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-1005s1c1
Sequence:CCGGAGGAGAGAAGATCACAGTCATCTCGAGATGACTGTGATCTTCTCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-952s1c1
Sequence:CCGGGTGGCTCTCTATCGGTTCAAACTCGAGTTTGAACCGATAGAGAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-593s1c1
Sequence:CCGGCCTATGTGGAAATGCAGAGATCTCGAGATCTCTGCATTTCCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-506s21c1
Sequence:CCGGATGTCTGTGCCCGGATGATTGCTCGAGCAATCATCCGGGCACAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-674s21c1
Sequence:CCGGAGCAGTACGCTTGTGTCAAAGCTCGAGCTTTGACACAAGCGTACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-927s21c1
Sequence:CCGGTGGCTTCCAGCAGTCTCATTACTCGAGTAATGAGACTGCTGGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145064
STAC3 MISSION shRNA Lentiviral Transduction Particles
SH3 and cysteine rich domain 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-436s1c1
Sequence:CCGGCCTCCTAAGCTGGTCAACGATCTCGAGATCGTTGACCAGCTTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-889s1c1
Sequence:CCGGGCTGAGAAGAAGACACCTGATCTCGAGATCAGGTGTCTTCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-1005s1c1
Sequence:CCGGAGGAGAGAAGATCACAGTCATCTCGAGATGACTGTGATCTTCTCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-952s1c1
Sequence:CCGGGTGGCTCTCTATCGGTTCAAACTCGAGTTTGAACCGATAGAGAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145064.x-593s1c1
Sequence:CCGGCCTATGTGGAAATGCAGAGATCTCGAGATCTCTGCATTTCCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-506s21c1
Sequence:CCGGATGTCTGTGCCCGGATGATTGCTCGAGCAATCATCCGGGCACAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-674s21c1
Sequence:CCGGAGCAGTACGCTTGTGTCAAAGCTCGAGCTTTGACACAAGCGTACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145064.1-927s21c1
Sequence:CCGGTGGCTTCCAGCAGTCTCATTACTCGAGTAATGAGACTGCTGGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177707
STAC3 MISSION shRNA Bacterial Glycerol Stock
SH3 and cysteine rich domain 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177707.2-1572s1c1
Sequence:CCGGCCACCAGAGCATAATGACGTTCTCGAGAACGTCATTATGCTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-443s1c1
Sequence:CCGGGCGACTGAAGCAGTTATTCAACTCGAGTTGAATAACTGCTTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-688s1c1
Sequence:CCGGCCCGGATGATTGTGCTCAATACTCGAGTATTGAGCACAATCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-1226s1c1
Sequence:CCGGCGGAGAGAAAGTCGGATTCTTCTCGAGAAGAATCCGACTTTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-687s1c1
Sequence:CCGGGCCCGGATGATTGTGCTCAATCTCGAGATTGAGCACAATCATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177707.3-635s21c1
Sequence:CCGGCACAAGTTCAAAGATCACTTCCTCGAGGAAGTGATCTTTGAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177707.3-605s21c1
Sequence:CCGGGAACCTCCTAAGCTCGTCAACCTCGAGGTTGACGAGCTTAGGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177707
STAC3 MISSION shRNA shRNA Plasmid DNA
SH3 and cysteine rich domain 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177707.2-1572s1c1
Sequence:CCGGCCACCAGAGCATAATGACGTTCTCGAGAACGTCATTATGCTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-443s1c1
Sequence:CCGGGCGACTGAAGCAGTTATTCAACTCGAGTTGAATAACTGCTTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-688s1c1
Sequence:CCGGCCCGGATGATTGTGCTCAATACTCGAGTATTGAGCACAATCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-1226s1c1
Sequence:CCGGCGGAGAGAAAGTCGGATTCTTCTCGAGAAGAATCCGACTTTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-687s1c1
Sequence:CCGGGCCCGGATGATTGTGCTCAATCTCGAGATTGAGCACAATCATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177707.3-635s21c1
Sequence:CCGGCACAAGTTCAAAGATCACTTCCTCGAGGAAGTGATCTTTGAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177707.3-605s21c1
Sequence:CCGGGAACCTCCTAAGCTCGTCAACCTCGAGGTTGACGAGCTTAGGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177707
STAC3 MISSION shRNA Lentiviral Transduction Particles
SH3 and cysteine rich domain 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177707.2-1572s1c1
Sequence:CCGGCCACCAGAGCATAATGACGTTCTCGAGAACGTCATTATGCTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-443s1c1
Sequence:CCGGGCGACTGAAGCAGTTATTCAACTCGAGTTGAATAACTGCTTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-688s1c1
Sequence:CCGGCCCGGATGATTGTGCTCAATACTCGAGTATTGAGCACAATCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-1226s1c1
Sequence:CCGGCGGAGAGAAAGTCGGATTCTTCTCGAGAAGAATCCGACTTTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177707.2-687s1c1
Sequence:CCGGGCCCGGATGATTGTGCTCAATCTCGAGATTGAGCACAATCATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177707.3-635s21c1
Sequence:CCGGCACAAGTTCAAAGATCACTTCCTCGAGGAAGTGATCTTTGAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177707.3-605s21c1
Sequence:CCGGGAACCTCCTAAGCTCGTCAACCTCGAGGTTGACGAGCTTAGGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks