EMAIL THIS PAGE TO A FRIEND

STAC

SH3 and cysteine rich domain

Synonyms: STAC1
UniProtKB ID: Q99469, B2R8S8
Gene ID:
Mouse(20840) src homology three (SH3) and cysteine rich domain
Rat(363152) SH3 and cysteine rich domain
chicken(428460) SH3 and cysteine rich domain
domestic cat(101092045) SH3 and cysteine rich domain
dog(477017) SH3 and cysteine rich domain
cow(524215) SH3 and cysteine rich domain
sheep(101107476) SH3 and cysteine rich domain
domestic guinea pig(100718692) SH3 and cysteine rich domain
naked mole-rat(101697037) SH3 and cysteine rich domain
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003149 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036371 MISSION® esiRNA esiRNA human STAC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003149 Rosetta Predictions human pricing
XM_001076458 Rosetta Predictions rat pricing
XM_343491 Rosetta Predictions rat pricing
NM_016853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206044 predicted 405
2 SASI_Hs01_00206046 predicted 900
3 SASI_Hs01_00206048 predicted 985
4 SASI_Hs02_00335152 predicted 799
5 SASI_Hs02_00335153 predicted 901
6 SASI_Hs01_00206049 predicted 1116
7 SASI_Hs01_00206050 predicted 451
8 SASI_Hs01_00206051 predicted 818
9 SASI_Hs01_00206052 predicted 564
10 SASI_Hs01_00206053 predicted 209
11 SASI_Hs01_00206045 predicted 1050
12 SASI_Hs01_00206047 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353292 predicted 1412
2 SASI_Rn02_00353293 predicted 1500
3 SASI_Rn02_00353294 predicted 941
4 SASI_Rn02_00353295 predicted 960
5 SASI_Rn02_00353296 predicted 1366
6 SASI_Rn02_00353297 predicted 1349
7 SASI_Rn02_00353298 predicted 1318
8 SASI_Rn02_00353299 predicted 1168
9 SASI_Rn02_00353300 predicted 1279
10 SASI_Rn02_00353301 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395854 predicted 2027
2 SASI_Rn02_00395855 predicted 2063
3 SASI_Rn02_00395856 predicted 719
4 SASI_Rn02_00395857 predicted 2121
5 SASI_Rn02_00395858 predicted 2070
6 SASI_Rn02_00395859 predicted 675
7 SASI_Rn02_00395860 predicted 1945
8 SASI_Rn02_00395861 predicted 1841
9 SASI_Rn02_00395862 predicted 2196
10 SASI_Rn02_00395863 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032663 predicted 1199
2 SASI_Mm01_00032664 predicted 1113
3 SASI_Mm01_00032665 predicted 598
4 SASI_Mm01_00032666 predicted 645
5 SASI_Mm01_00032667 predicted 1416
6 SASI_Mm01_00032668 predicted 1060
7 SASI_Mm01_00032669 predicted 1046
8 SASI_Mm01_00032670 predicted 1016
9 SASI_Mm02_00323631 predicted 1100
10 SASI_Mm01_00032671 predicted 525
11 SASI_Mm01_00032672 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016853
STAC MISSION shRNA Bacterial Glycerol Stock
SH3 and cysteine rich domain
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016853.1-1771s1c1
Sequence:CCGGGCTCAGTTTGTGTCTCAGTTTCTCGAGAAACTGAGACACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-960s1c1
Sequence:CCGGCCCATTACAGATGAACACCTACTCGAGTAGGTGTTCATCTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-237s1c1
Sequence:CCGGGTCACTTTCTTTCAAGACCAACTCGAGTTGGTCTTGAAAGAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-1117s1c1
Sequence:CCGGGCCAACTTTGTTCAGAGAGTACTCGAGTACTCTCTGAACAAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-1140s21c1
Sequence:CCGGAGAGCATGAGAAGATTTATAGCTCGAGCTATAAATCTTCTCATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-863s21c1
Sequence:CCGGCACGGAGCAACAGTGTGTTTACTCGAGTAAACACACTGTTGCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-213s21c1
Sequence:CCGGATCCAAGCTCCAGAAACTAAACTCGAGTTTAGTTTCTGGAGCTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-904s21c1
Sequence:CCGGGATGACTTCAGAGATCAAATGCTCGAGCATTTGATCTCTGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016853
STAC MISSION shRNA shRNA Plasmid DNA
SH3 and cysteine rich domain
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016853.1-1771s1c1
Sequence:CCGGGCTCAGTTTGTGTCTCAGTTTCTCGAGAAACTGAGACACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-960s1c1
Sequence:CCGGCCCATTACAGATGAACACCTACTCGAGTAGGTGTTCATCTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-237s1c1
Sequence:CCGGGTCACTTTCTTTCAAGACCAACTCGAGTTGGTCTTGAAAGAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-1117s1c1
Sequence:CCGGGCCAACTTTGTTCAGAGAGTACTCGAGTACTCTCTGAACAAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-1140s21c1
Sequence:CCGGAGAGCATGAGAAGATTTATAGCTCGAGCTATAAATCTTCTCATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-863s21c1
Sequence:CCGGCACGGAGCAACAGTGTGTTTACTCGAGTAAACACACTGTTGCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-213s21c1
Sequence:CCGGATCCAAGCTCCAGAAACTAAACTCGAGTTTAGTTTCTGGAGCTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-904s21c1
Sequence:CCGGGATGACTTCAGAGATCAAATGCTCGAGCATTTGATCTCTGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016853
STAC MISSION shRNA Lentiviral Transduction Particles
SH3 and cysteine rich domain
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016853.1-1771s1c1
Sequence:CCGGGCTCAGTTTGTGTCTCAGTTTCTCGAGAAACTGAGACACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-960s1c1
Sequence:CCGGCCCATTACAGATGAACACCTACTCGAGTAGGTGTTCATCTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-237s1c1
Sequence:CCGGGTCACTTTCTTTCAAGACCAACTCGAGTTGGTCTTGAAAGAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016853.1-1117s1c1
Sequence:CCGGGCCAACTTTGTTCAGAGAGTACTCGAGTACTCTCTGAACAAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-1140s21c1
Sequence:CCGGAGAGCATGAGAAGATTTATAGCTCGAGCTATAAATCTTCTCATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-863s21c1
Sequence:CCGGCACGGAGCAACAGTGTGTTTACTCGAGTAAACACACTGTTGCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-213s21c1
Sequence:CCGGATCCAAGCTCCAGAAACTAAACTCGAGTTTAGTTTCTGGAGCTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016853.2-904s21c1
Sequence:CCGGGATGACTTCAGAGATCAAATGCTCGAGCATTTGATCTCTGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003149
STAC MISSION shRNA Bacterial Glycerol Stock
SH3 and cysteine rich domain
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-183s1c1
Sequence:CCGGGACCAAGAGTTTACGGAGCAACTCGAGTTGCTCCGTAAACTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-1042s1c1
Sequence:CCGGCCAGCCAACTTTGTTCAGAGACTCGAGTCTCTGAACAAAGTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003149.1-1971s1c1
Sequence:CCGGGCAGGACATGAGACATAGATACTCGAGTATCTATGTCTCATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-392s1c1
Sequence:CCGGCCACTTTCTGTGATGTCTGCACTCGAGTGCAGACATCACAGAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-139s1c1
Sequence:CCGGCAGGAATCCAAGCTCCAGAAACTCGAGTTTCTGGAGCTTGGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-414s1c1
Sequence:CCGGCCACATGATAGTGGGAACAAACTCGAGTTTGTTCCCACTATCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-961s1c1
Sequence:CCGGCCAGGAGACATAATTACTCTTCTCGAGAAGAGTAATTATGTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-587s1c1
Sequence:CCGGGCATTAAAGAAGTTATGCCCACTCGAGTGGGCATAACTTCTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-908s21c1
Sequence:CCGGATGTTGCCTTGTACAAATTTGCTCGAGCAAATTTGTACAAGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-843s21c1
Sequence:CCGGAGATCCAGCGAAGAACATAAACTCGAGTTTATGTTCTTCGCTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-574s21c1
Sequence:CCGGGAACAGTTTGGCTGCATTAAACTCGAGTTTAATGCAGCCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003149.1-1624s21c1
Sequence:CCGGATCCATGTAGCTAAGTATTATCTCGAGATAATACTTAGCTACATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003149
STAC MISSION shRNA shRNA Plasmid DNA
SH3 and cysteine rich domain
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-183s1c1
Sequence:CCGGGACCAAGAGTTTACGGAGCAACTCGAGTTGCTCCGTAAACTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-1042s1c1
Sequence:CCGGCCAGCCAACTTTGTTCAGAGACTCGAGTCTCTGAACAAAGTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003149.1-1971s1c1
Sequence:CCGGGCAGGACATGAGACATAGATACTCGAGTATCTATGTCTCATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-392s1c1
Sequence:CCGGCCACTTTCTGTGATGTCTGCACTCGAGTGCAGACATCACAGAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-139s1c1
Sequence:CCGGCAGGAATCCAAGCTCCAGAAACTCGAGTTTCTGGAGCTTGGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-414s1c1
Sequence:CCGGCCACATGATAGTGGGAACAAACTCGAGTTTGTTCCCACTATCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-961s1c1
Sequence:CCGGCCAGGAGACATAATTACTCTTCTCGAGAAGAGTAATTATGTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-587s1c1
Sequence:CCGGGCATTAAAGAAGTTATGCCCACTCGAGTGGGCATAACTTCTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-908s21c1
Sequence:CCGGATGTTGCCTTGTACAAATTTGCTCGAGCAAATTTGTACAAGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-843s21c1
Sequence:CCGGAGATCCAGCGAAGAACATAAACTCGAGTTTATGTTCTTCGCTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-574s21c1
Sequence:CCGGGAACAGTTTGGCTGCATTAAACTCGAGTTTAATGCAGCCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003149.1-1624s21c1
Sequence:CCGGATCCATGTAGCTAAGTATTATCTCGAGATAATACTTAGCTACATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003149
STAC MISSION shRNA Lentiviral Transduction Particles
SH3 and cysteine rich domain
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-183s1c1
Sequence:CCGGGACCAAGAGTTTACGGAGCAACTCGAGTTGCTCCGTAAACTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-1042s1c1
Sequence:CCGGCCAGCCAACTTTGTTCAGAGACTCGAGTCTCTGAACAAAGTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003149.1-1971s1c1
Sequence:CCGGGCAGGACATGAGACATAGATACTCGAGTATCTATGTCTCATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-392s1c1
Sequence:CCGGCCACTTTCTGTGATGTCTGCACTCGAGTGCAGACATCACAGAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-139s1c1
Sequence:CCGGCAGGAATCCAAGCTCCAGAAACTCGAGTTTCTGGAGCTTGGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-414s1c1
Sequence:CCGGCCACATGATAGTGGGAACAAACTCGAGTTTGTTCCCACTATCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003149.1-961s1c1
Sequence:CCGGCCAGGAGACATAATTACTCTTCTCGAGAAGAGTAATTATGTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003149.1-587s1c1
Sequence:CCGGGCATTAAAGAAGTTATGCCCACTCGAGTGGGCATAACTTCTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-908s21c1
Sequence:CCGGATGTTGCCTTGTACAAATTTGCTCGAGCAAATTTGTACAAGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-843s21c1
Sequence:CCGGAGATCCAGCGAAGAACATAAACTCGAGTTTATGTTCTTCGCTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003149.1-574s21c1
Sequence:CCGGGAACAGTTTGGCTGCATTAAACTCGAGTTTAATGCAGCCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003149.1-1624s21c1
Sequence:CCGGATCCATGTAGCTAAGTATTATCTCGAGATAATACTTAGCTACATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks