EMAIL THIS PAGE TO A FRIEND

STAG1

stromal antigen 1

Synonyms: SA1 SCC3A
UniProtKB ID: Q8WVM7, O00539
Gene ID:
Human(10274) Summary: This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
Mouse(20842) stromal antigen 1
Rat(315958) stromal antigen 1
naked mole-rat(101698509) stromal antigen 1
Domestic Rabbit(100347587) stromal antigen 1
domestic guinea pig(100724410) stromal antigen 1
cow(539234) stromal antigen 1
sheep(101113301) stromal antigen 1
chicken(424735) stromal antigen 1
dog(485674) stromal antigen 1
Horse(100066027) stromal antigen 1
Gene Class: Cell_Division
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701220 Anti-STAG1 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA035015 Anti-STAG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701221 Anti-STAG1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA058653 Anti-STAG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
PLA0053 Goat anti-SA1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, toad, human, mouse, gibbon
immunofluorescence, proximity ligation assay, western blot pricing
WH0010274M1 Monoclonal Anti-STAG1 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702336 Monoclonal Anti-STAG1 antibody produced in mouse clone GT8810, affinity isolated antibody human
western blot pricing
SAB2702339 Monoclonal Anti-STAG1 antibody produced in mouse clone GT1515, affinity isolated antibody human
western blot pricing
PLA0260 Rabbit anti-SA1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, guinea pig, pig, bovine, marmoset, mouse, human, rhesus monkey, chimpanzee, rat, dog
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005862 Rosetta Predictions human pricing
NM_001108179 Rosetta Predictions rat pricing
NM_009282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340420 predicted 1228
2 SASI_Hs01_00035716 predicted 3345
3 SASI_Hs01_00035718 predicted 3994
4 SASI_Hs02_00340421 predicted 2888
5 SASI_Hs01_00035719 predicted 1033
6 SASI_Hs01_00035721 predicted 2364
7 SASI_Hs01_00035722 predicted 1461
8 SASI_Hs02_00340422 predicted 1755
9 SASI_Hs02_00340423 predicted 1625
10 SASI_Hs02_00340424 predicted 2278
11 SASI_Hs01_00035717 predicted 1797
12 SASI_Hs01_00035720 predicted 1812
13 SASI_Hs01_00035723 predicted 1869
14 SASI_Hs01_00035724 predicted 315
15 SASI_Hs01_00035725 predicted 2072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236114 predicted 694
2 SASI_Rn02_00236115 predicted 3167
3 SASI_Rn02_00236116 predicted 2605
4 SASI_Rn02_00236117 predicted 3022
5 SASI_Rn02_00236118 predicted 2409
6 SASI_Rn02_00236119 predicted 1000
7 SASI_Rn02_00236120 predicted 3581
8 SASI_Rn02_00236121 predicted 2653
9 SASI_Rn02_00236122 predicted 1039
10 SASI_Rn02_00236123 predicted 3708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099486 predicted 2964
2 SASI_Mm01_00099487 predicted 2364
3 SASI_Mm01_00099488 predicted 4072
4 SASI_Mm01_00099489 predicted 2933
5 SASI_Mm01_00099490 predicted 1339
6 SASI_Mm01_00099491 predicted 3383
7 SASI_Mm01_00099492 predicted 2197
8 SASI_Mm01_00099493 predicted 3055
9 SASI_Mm01_00099494 predicted 1343
10 SASI_Mm02_00315783 predicted 2595
11 SASI_Mm01_00099485 predicted 3527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009282
STAG1 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009282.3-2922s21c1
Sequence:CCGGACTACATGAAGTATTACAATGCTCGAGCATTGTAATACTTCATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009282.3-2524s21c1
Sequence:CCGGAGAGGATTTGTTGGTATTGAGCTCGAGCTCAATACCAACAAATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009282.2-5724s1c1
Sequence:CCGGCCCTGGAATAAGCACAGATAACTCGAGTTATCTGTGCTTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-370s1c1
Sequence:CCGGCCGGCCTCCATCAACAAATAACTCGAGTTATTTGTTGATGGAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-941s1c1
Sequence:CCGGGCTCTGGTGAATGTTGCTTTACTCGAGTAAAGCAACATTCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-2193s1c1
Sequence:CCGGCCATTCAGAATCGAGTTGATACTCGAGTATCAACTCGATTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-3977s1c1
Sequence:CCGGGCAGCTATCATAGAAGATGATCTCGAGATCATCTTCTATGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009282
STAG1 MISSION shRNA shRNA Plasmid DNA
stromal antigen 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009282.3-2922s21c1
Sequence:CCGGACTACATGAAGTATTACAATGCTCGAGCATTGTAATACTTCATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009282.3-2524s21c1
Sequence:CCGGAGAGGATTTGTTGGTATTGAGCTCGAGCTCAATACCAACAAATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009282.2-5724s1c1
Sequence:CCGGCCCTGGAATAAGCACAGATAACTCGAGTTATCTGTGCTTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-370s1c1
Sequence:CCGGCCGGCCTCCATCAACAAATAACTCGAGTTATTTGTTGATGGAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-941s1c1
Sequence:CCGGGCTCTGGTGAATGTTGCTTTACTCGAGTAAAGCAACATTCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-2193s1c1
Sequence:CCGGCCATTCAGAATCGAGTTGATACTCGAGTATCAACTCGATTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-3977s1c1
Sequence:CCGGGCAGCTATCATAGAAGATGATCTCGAGATCATCTTCTATGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009282
STAG1 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009282.3-2922s21c1
Sequence:CCGGACTACATGAAGTATTACAATGCTCGAGCATTGTAATACTTCATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009282.3-2524s21c1
Sequence:CCGGAGAGGATTTGTTGGTATTGAGCTCGAGCTCAATACCAACAAATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009282.2-5724s1c1
Sequence:CCGGCCCTGGAATAAGCACAGATAACTCGAGTTATCTGTGCTTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-370s1c1
Sequence:CCGGCCGGCCTCCATCAACAAATAACTCGAGTTATTTGTTGATGGAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-941s1c1
Sequence:CCGGGCTCTGGTGAATGTTGCTTTACTCGAGTAAAGCAACATTCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-2193s1c1
Sequence:CCGGCCATTCAGAATCGAGTTGATACTCGAGTATCAACTCGATTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009282.2-3977s1c1
Sequence:CCGGGCAGCTATCATAGAAGATGATCTCGAGATCATCTTCTATGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005862
VALIDATED
STAG1 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-2480s21c1
Sequence:CCGGCCAGAACAGATAGTCGTGCAACTCGAGTTGCACGACTATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-465s21c1
Sequence:CCGGGCAGAATTGAAGCTGGAATTACTCGAGTAATTCCAGCTTCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-1583s21c1
Sequence:CCGGGCTGGAGAGTTCCTTCACAAACTCGAGTTTGTGAAGGAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-2402s1c1
Sequence:CCGGCGATTCAATCATTCTGTGGAACTCGAGTTCCACAGAATGATTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-3678s1c1
Sequence:CCGGGTCTGGATAACACATGGCTAACTCGAGTTAGCCATGTGTTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-2840s1c1
Sequence:CCGGCTTCAGCCTTTGGTGTTCAATCTCGAGATTGAACACCAAAGGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1691s1c1
Sequence:CCGGGCTGGAGAGTTCCTTCACAAACTCGAGTTTGTGAAGGAACTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1776s1c1
Sequence:CCGGGCCCGAATGGAAACCTCATTACTCGAGTAATGAGGTTTCCATTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-3269s1c1
Sequence:CCGGCGTCGCTTTGCCCTTACATTTCTCGAGAAATGTAAGGGCAAAGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-2588s1c1
Sequence:CCGGCCAGAACAGATAGTCGTGCAACTCGAGTTGCACGACTATCTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-1094s1c1
Sequence:CCGGGCTCTGGTGAATGTTGCCTTACTCGAGTAAGGCAACATTCACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-1301s1c1
Sequence:CCGGCGTGATGCTATTGCTGAGATTCTCGAGAATCTCAGCAATAGCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-475s1c1
Sequence:CCGGGCTTGAAGAAACAGAGGTCAACTCGAGTTGACCTCTGTTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1187s1c1
Sequence:CCGGGCCAATGAAAGGTTGGAGTTACTCGAGTAACTCCAACCTTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-573s1c1
Sequence:CCGGGCAGAATTGAAGCTGGAATTACTCGAGTAATTCCAGCTTCAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-4130s1c1
Sequence:CCGGGCAGCTATCATAGAAGATGATCTCGAGATCATCTTCTATGATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005862
VALIDATED
STAG1 MISSION shRNA shRNA Plasmid DNA
stromal antigen 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-2480s21c1
Sequence:CCGGCCAGAACAGATAGTCGTGCAACTCGAGTTGCACGACTATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-465s21c1
Sequence:CCGGGCAGAATTGAAGCTGGAATTACTCGAGTAATTCCAGCTTCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-1583s21c1
Sequence:CCGGGCTGGAGAGTTCCTTCACAAACTCGAGTTTGTGAAGGAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-2402s1c1
Sequence:CCGGCGATTCAATCATTCTGTGGAACTCGAGTTCCACAGAATGATTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-3678s1c1
Sequence:CCGGGTCTGGATAACACATGGCTAACTCGAGTTAGCCATGTGTTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-2840s1c1
Sequence:CCGGCTTCAGCCTTTGGTGTTCAATCTCGAGATTGAACACCAAAGGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1691s1c1
Sequence:CCGGGCTGGAGAGTTCCTTCACAAACTCGAGTTTGTGAAGGAACTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1776s1c1
Sequence:CCGGGCCCGAATGGAAACCTCATTACTCGAGTAATGAGGTTTCCATTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-3269s1c1
Sequence:CCGGCGTCGCTTTGCCCTTACATTTCTCGAGAAATGTAAGGGCAAAGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-2588s1c1
Sequence:CCGGCCAGAACAGATAGTCGTGCAACTCGAGTTGCACGACTATCTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-1094s1c1
Sequence:CCGGGCTCTGGTGAATGTTGCCTTACTCGAGTAAGGCAACATTCACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-1301s1c1
Sequence:CCGGCGTGATGCTATTGCTGAGATTCTCGAGAATCTCAGCAATAGCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-475s1c1
Sequence:CCGGGCTTGAAGAAACAGAGGTCAACTCGAGTTGACCTCTGTTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1187s1c1
Sequence:CCGGGCCAATGAAAGGTTGGAGTTACTCGAGTAACTCCAACCTTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-573s1c1
Sequence:CCGGGCAGAATTGAAGCTGGAATTACTCGAGTAATTCCAGCTTCAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-4130s1c1
Sequence:CCGGGCAGCTATCATAGAAGATGATCTCGAGATCATCTTCTATGATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005862
VALIDATED
STAG1 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-2480s21c1
Sequence:CCGGCCAGAACAGATAGTCGTGCAACTCGAGTTGCACGACTATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-465s21c1
Sequence:CCGGGCAGAATTGAAGCTGGAATTACTCGAGTAATTCCAGCTTCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005862.2-1583s21c1
Sequence:CCGGGCTGGAGAGTTCCTTCACAAACTCGAGTTTGTGAAGGAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-2402s1c1
Sequence:CCGGCGATTCAATCATTCTGTGGAACTCGAGTTCCACAGAATGATTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-3678s1c1
Sequence:CCGGGTCTGGATAACACATGGCTAACTCGAGTTAGCCATGTGTTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-2840s1c1
Sequence:CCGGCTTCAGCCTTTGGTGTTCAATCTCGAGATTGAACACCAAAGGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1691s1c1
Sequence:CCGGGCTGGAGAGTTCCTTCACAAACTCGAGTTTGTGAAGGAACTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1776s1c1
Sequence:CCGGGCCCGAATGGAAACCTCATTACTCGAGTAATGAGGTTTCCATTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-3269s1c1
Sequence:CCGGCGTCGCTTTGCCCTTACATTTCTCGAGAAATGTAAGGGCAAAGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-2588s1c1
Sequence:CCGGCCAGAACAGATAGTCGTGCAACTCGAGTTGCACGACTATCTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-1094s1c1
Sequence:CCGGGCTCTGGTGAATGTTGCCTTACTCGAGTAAGGCAACATTCACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005862.1-1301s1c1
Sequence:CCGGCGTGATGCTATTGCTGAGATTCTCGAGAATCTCAGCAATAGCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005862.1-475s1c1
Sequence:CCGGGCTTGAAGAAACAGAGGTCAACTCGAGTTGACCTCTGTTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-1187s1c1
Sequence:CCGGGCCAATGAAAGGTTGGAGTTACTCGAGTAACTCCAACCTTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-573s1c1
Sequence:CCGGGCAGAATTGAAGCTGGAATTACTCGAGTAATTCCAGCTTCAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005862.1-4130s1c1
Sequence:CCGGGCAGCTATCATAGAAGATGATCTCGAGATCATCTTCTATGATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks