EMAIL THIS PAGE TO A FRIEND

STAG2

stromal antigen 2

Synonyms: SA-2 SA2 SCC3B bA517O1.1
Gene ID:
Mouse(20843) stromal antigen 2
Rat(313304) stromal antigen 2
chicken(422360) stromal antigen 2
domestic cat(101096213) stromal antigen 2
Horse(100055046) stromal antigen 2
dog(492111) stromal antigen 2
cow(616487) stromal antigen 2
sheep(101116633) stromal antigen 2
domestic guinea pig(100720947) stromal antigen 2
Domestic Rabbit(100328701) stromal antigen 2
naked mole-rat(101716438) stromal antigen 2
216 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042749 Rosetta Predictions human pricing
NM_001042750 Rosetta Predictions human pricing
NM_001042751 Rosetta Predictions human pricing
NM_006603 Rosetta Predictions human pricing
XM_001059059 Rosetta Predictions rat pricing
XM_233108 Rosetta Predictions rat pricing
NM_001077712 Rosetta Predictions mouse pricing
NM_021465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311139 predicted 1608
2 SASI_Hs02_00311140 predicted 1326
3 SASI_Hs02_00311141 predicted 2382
4 SASI_Hs02_00311142 predicted 3140
5 SASI_Hs02_00311143 predicted 2154
6 SASI_Hs02_00311144 predicted 2737
7 SASI_Hs02_00311145 predicted 1528
8 SASI_Hs02_00311146 predicted 1325
9 SASI_Hs02_00311147 predicted 2718
10 SASI_Hs02_00311148 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311149 predicted 1521
2 SASI_Hs02_00311150 predicted 1234
3 SASI_Hs02_00311151 predicted 2294
4 SASI_Hs02_00311152 predicted 3048
5 SASI_Hs02_00311153 predicted 2058
6 SASI_Hs02_00311154 predicted 2645
7 SASI_Hs02_00311155 predicted 1435
8 SASI_Hs02_00311156 predicted 1235
9 SASI_Hs02_00311157 predicted 2632
10 SASI_Hs02_00311158 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311159 predicted 1513
2 SASI_Hs02_00311160 predicted 1243
3 SASI_Hs02_00311161 predicted 2292
4 SASI_Hs02_00311162 predicted 3049
5 SASI_Hs02_00311163 predicted 2062
6 SASI_Hs02_00311164 predicted 2646
7 SASI_Hs02_00311165 predicted 1432
8 SASI_Hs02_00311166 predicted 1231
9 SASI_Hs02_00311167 predicted 2631
10 SASI_Hs02_00311168 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341929 predicted 1451
2 SASI_Hs02_00341930 predicted 1174
3 SASI_Hs01_00245113 predicted 2230
4 SASI_Hs01_00245115 predicted 2989
5 SASI_Hs01_00245116 predicted 1994
6 SASI_Hs01_00245117 predicted 2577
7 SASI_Hs02_00341931 predicted 1364
8 SASI_Hs01_00245118 predicted 1161
9 SASI_Hs01_00245119 predicted 2561
10 SASI_Hs01_00245120 predicted 656
11 SASI_Hs01_00245112 predicted 3755
12 SASI_Hs01_00245114 predicted 1772
13 SASI_Hs01_00245121 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291788 predicted 1189
2 SASI_Rn02_00291789 predicted 3826
3 SASI_Rn02_00291790 predicted 1551
4 SASI_Rn02_00291791 predicted 3678
5 SASI_Rn02_00291792 predicted 3113
6 SASI_Rn02_00291793 predicted 3471
7 SASI_Rn02_00291794 predicted 2786
8 SASI_Rn02_00291795 predicted 3653
9 SASI_Rn02_00291796 predicted 2282
10 SASI_Rn02_00291797 predicted 2437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387420 predicted 1196
2 SASI_Rn02_00387421 predicted 3821
3 SASI_Rn02_00387422 predicted 1550
4 SASI_Rn02_00387423 predicted 3682
5 SASI_Rn02_00387424 predicted 3112
6 SASI_Rn02_00387425 predicted 3469
7 SASI_Rn02_00387426 predicted 2789
8 SASI_Rn02_00387427 predicted 3649
9 SASI_Rn02_00387428 predicted 2280
10 SASI_Rn02_00387429 predicted 2438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292952 predicted 1458
2 SASI_Mm02_00292953 predicted 3028
3 SASI_Mm02_00292954 predicted 2409
4 SASI_Mm02_00292955 predicted 3731
5 SASI_Mm02_00292956 predicted 3906
6 SASI_Mm02_00292957 predicted 1283
7 SASI_Mm02_00292958 predicted 2349
8 SASI_Mm02_00292959 predicted 2685
9 SASI_Mm02_00292960 predicted 1850
10 SASI_Mm02_00292961 predicted 3564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326119 predicted 1317
2 SASI_Mm01_00137419 predicted 2886
3 SASI_Mm01_00137420 predicted 2276
4 SASI_Mm01_00137421 predicted 3591
5 SASI_Mm01_00137423 predicted 3765
6 SASI_Mm01_00137424 predicted 1144
7 SASI_Mm01_00137426 predicted 2207
8 SASI_Mm01_00137427 predicted 2543
9 SASI_Mm02_00326120 predicted 1715
10 SASI_Mm01_00137428 predicted 3420
11 SASI_Mm01_00137422 predicted 3409
12 SASI_Mm01_00137425 predicted 1164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006603
VALIDATED
STAG2 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-414s1c1
Sequence:CCGGCCAAACCGAATGAATGGTCATCTCGAGATGACCATTCATTCGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-4294s1c1
Sequence:CCGGCCTCTGCTGGATTTCTGTTTACTCGAGTAAACAGAAATCCAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006603.3-2427s1c1
Sequence:CCGGCACTATGTAATCCTTTGGCAACTCGAGTTGCCAAAGGATTACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-3040s1c1
Sequence:CCGGCCTCTACATTTAGTGGCATAACTCGAGTTATGCCACTAAATGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006603.3-4029s1c1
Sequence:CCGGGCTTATGCTTACCAAGATCAACTCGAGTTGATCTTGGTAAGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006603.3-5658s1c1
Sequence:CCGGGCAGTTCTTACAGCTTTGTTTCTCGAGAAACAAAGCTGTAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006603.3-2545s1c1
Sequence:CCGGCCAACGTGAATACTACTGTTACTCGAGTAACAGTAGTATTCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-5000s1c1
Sequence:CCGGGCAAGCAGTCTTCAGGTTAAACTCGAGTTTAACCTGAAGACTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-1741s1c1
Sequence:CCGGGAGAGGAAGCACTAACAGATACTCGAGTATCTGTTAGTGCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006603.3-3333s1c1
Sequence:CCGGCCACTGATGTCTTACCGAAATCTCGAGATTTCGGTAAGACATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006603.4-5033s21c1
Sequence:CCGGGCAAGCAGTCTTCAGGTTAAACTCGAGTTTAACCTGAAGACTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006603.4-5691s21c1
Sequence:CCGGGCAGTTCTTACAGCTTTGTTTCTCGAGAAACAAAGCTGTAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006603.4-3366s21c1
Sequence:CCGGCCACTGATGTCTTACCGAAATCTCGAGATTTCGGTAAGACATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006603.4-1774s21c1
Sequence:CCGGGAGAGGAAGCACTAACAGATACTCGAGTATCTGTTAGTGCTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006603
VALIDATED
STAG2 MISSION shRNA shRNA Plasmid DNA
stromal antigen 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-414s1c1
Sequence:CCGGCCAAACCGAATGAATGGTCATCTCGAGATGACCATTCATTCGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-4294s1c1
Sequence:CCGGCCTCTGCTGGATTTCTGTTTACTCGAGTAAACAGAAATCCAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006603.3-2427s1c1
Sequence:CCGGCACTATGTAATCCTTTGGCAACTCGAGTTGCCAAAGGATTACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-3040s1c1
Sequence:CCGGCCTCTACATTTAGTGGCATAACTCGAGTTATGCCACTAAATGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006603.3-4029s1c1
Sequence:CCGGGCTTATGCTTACCAAGATCAACTCGAGTTGATCTTGGTAAGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006603.3-5658s1c1
Sequence:CCGGGCAGTTCTTACAGCTTTGTTTCTCGAGAAACAAAGCTGTAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006603.3-2545s1c1
Sequence:CCGGCCAACGTGAATACTACTGTTACTCGAGTAACAGTAGTATTCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-5000s1c1
Sequence:CCGGGCAAGCAGTCTTCAGGTTAAACTCGAGTTTAACCTGAAGACTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-1741s1c1
Sequence:CCGGGAGAGGAAGCACTAACAGATACTCGAGTATCTGTTAGTGCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006603.3-3333s1c1
Sequence:CCGGCCACTGATGTCTTACCGAAATCTCGAGATTTCGGTAAGACATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006603.4-5033s21c1
Sequence:CCGGGCAAGCAGTCTTCAGGTTAAACTCGAGTTTAACCTGAAGACTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006603.4-5691s21c1
Sequence:CCGGGCAGTTCTTACAGCTTTGTTTCTCGAGAAACAAAGCTGTAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006603.4-3366s21c1
Sequence:CCGGCCACTGATGTCTTACCGAAATCTCGAGATTTCGGTAAGACATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006603.4-1774s21c1
Sequence:CCGGGAGAGGAAGCACTAACAGATACTCGAGTATCTGTTAGTGCTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006603
VALIDATED
STAG2 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-414s1c1
Sequence:CCGGCCAAACCGAATGAATGGTCATCTCGAGATGACCATTCATTCGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-4294s1c1
Sequence:CCGGCCTCTGCTGGATTTCTGTTTACTCGAGTAAACAGAAATCCAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006603.3-2427s1c1
Sequence:CCGGCACTATGTAATCCTTTGGCAACTCGAGTTGCCAAAGGATTACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-3040s1c1
Sequence:CCGGCCTCTACATTTAGTGGCATAACTCGAGTTATGCCACTAAATGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006603.3-4029s1c1
Sequence:CCGGGCTTATGCTTACCAAGATCAACTCGAGTTGATCTTGGTAAGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006603.3-5658s1c1
Sequence:CCGGGCAGTTCTTACAGCTTTGTTTCTCGAGAAACAAAGCTGTAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006603.3-2545s1c1
Sequence:CCGGCCAACGTGAATACTACTGTTACTCGAGTAACAGTAGTATTCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-5000s1c1
Sequence:CCGGGCAAGCAGTCTTCAGGTTAAACTCGAGTTTAACCTGAAGACTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006603.3-1741s1c1
Sequence:CCGGGAGAGGAAGCACTAACAGATACTCGAGTATCTGTTAGTGCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006603.3-3333s1c1
Sequence:CCGGCCACTGATGTCTTACCGAAATCTCGAGATTTCGGTAAGACATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006603.4-5033s21c1
Sequence:CCGGGCAAGCAGTCTTCAGGTTAAACTCGAGTTTAACCTGAAGACTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006603.4-5691s21c1
Sequence:CCGGGCAGTTCTTACAGCTTTGTTTCTCGAGAAACAAAGCTGTAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006603.4-3366s21c1
Sequence:CCGGCCACTGATGTCTTACCGAAATCTCGAGATTTCGGTAAGACATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006603.4-1774s21c1
Sequence:CCGGGAGAGGAAGCACTAACAGATACTCGAGTATCTGTTAGTGCTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021465
VALIDATED
STAG2 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-4237s1c1
Sequence:CCGGCGACCCTGAAATTGTAGGATACTCGAGTATCCTACAATTTCAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-2936s1c1
Sequence:CCGGCCTCAACATTTAGTGGCATAACTCGAGTTATGCCACTAAATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021465.2-3746s1c1
Sequence:CCGGCCGATTTCTTTGATCCAGCTTCTCGAGAAGCTGGATCAAAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-2146s1c1
Sequence:CCGGCCTGATGAAGATGACGCATATCTCGAGATATGCGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-448s1c1
Sequence:CCGGGCGCTTCTTGACCTTATCAATCTCGAGATTGATAAGGTCAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-972s21c1
Sequence:CCGGTACGAGGCAGAACGGAATAAACTCGAGTTTATTCCGTTCTGCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-2265s21c1
Sequence:CCGGCCTGATGAAGATGACGCATATCTCGAGATATGCGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-567s21c1
Sequence:CCGGGCGCTTCTTGACCTTATCAATCTCGAGATTGATAAGGTCAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021465.3-4249s21c1
Sequence:CCGGGATAAGAATCTTCTCACATTTCTCGAGAAATGTGAGAAGATTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-2066s21c1
Sequence:CCGGATTGCGCCAGATCCGAAATATCTCGAGATATTTCGGATCTGGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021465
VALIDATED
STAG2 MISSION shRNA shRNA Plasmid DNA
stromal antigen 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-4237s1c1
Sequence:CCGGCGACCCTGAAATTGTAGGATACTCGAGTATCCTACAATTTCAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-2936s1c1
Sequence:CCGGCCTCAACATTTAGTGGCATAACTCGAGTTATGCCACTAAATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021465.2-3746s1c1
Sequence:CCGGCCGATTTCTTTGATCCAGCTTCTCGAGAAGCTGGATCAAAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-2146s1c1
Sequence:CCGGCCTGATGAAGATGACGCATATCTCGAGATATGCGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-448s1c1
Sequence:CCGGGCGCTTCTTGACCTTATCAATCTCGAGATTGATAAGGTCAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-972s21c1
Sequence:CCGGTACGAGGCAGAACGGAATAAACTCGAGTTTATTCCGTTCTGCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-2265s21c1
Sequence:CCGGCCTGATGAAGATGACGCATATCTCGAGATATGCGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-567s21c1
Sequence:CCGGGCGCTTCTTGACCTTATCAATCTCGAGATTGATAAGGTCAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021465.3-4249s21c1
Sequence:CCGGGATAAGAATCTTCTCACATTTCTCGAGAAATGTGAGAAGATTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-2066s21c1
Sequence:CCGGATTGCGCCAGATCCGAAATATCTCGAGATATTTCGGATCTGGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021465
VALIDATED
STAG2 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-4237s1c1
Sequence:CCGGCGACCCTGAAATTGTAGGATACTCGAGTATCCTACAATTTCAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-2936s1c1
Sequence:CCGGCCTCAACATTTAGTGGCATAACTCGAGTTATGCCACTAAATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021465.2-3746s1c1
Sequence:CCGGCCGATTTCTTTGATCCAGCTTCTCGAGAAGCTGGATCAAAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-2146s1c1
Sequence:CCGGCCTGATGAAGATGACGCATATCTCGAGATATGCGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021465.2-448s1c1
Sequence:CCGGGCGCTTCTTGACCTTATCAATCTCGAGATTGATAAGGTCAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-972s21c1
Sequence:CCGGTACGAGGCAGAACGGAATAAACTCGAGTTTATTCCGTTCTGCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-2265s21c1
Sequence:CCGGCCTGATGAAGATGACGCATATCTCGAGATATGCGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-567s21c1
Sequence:CCGGGCGCTTCTTGACCTTATCAATCTCGAGATTGATAAGGTCAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021465.3-4249s21c1
Sequence:CCGGGATAAGAATCTTCTCACATTTCTCGAGAAATGTGAGAAGATTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021465.3-2066s21c1
Sequence:CCGGATTGCGCCAGATCCGAAATATCTCGAGATATTTCGGATCTGGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks