EMAIL THIS PAGE TO A FRIEND

STAG3

stromal antigen 3

UniProtKB ID: Q9UJ98, A6H8Z1, D6W5U8, Q8NDP3
Gene ID:
Mouse(50878) stromal antigen 3
Rat(114522) stromal antigen 3
chicken(418671) stromal antigen 3
Horse(100068898) stromal antigen 3
domestic cat(101099169) stromal antigen 3
dog(489842) stromal antigen 3
naked mole-rat(101721552) stromal antigen 3
Domestic Rabbit(100340826) stromal antigen 3
domestic guinea pig(100716544) stromal antigen 3
cow(515399) stromal antigen 3
sheep(101106486) stromal antigen 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012447 Rosetta Predictions human pricing
NM_053730 Rosetta Predictions rat pricing
NM_016964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169453 predicted 771
2 SASI_Hs02_00344348 predicted 573
3 SASI_Hs01_00169456 predicted 2554
4 SASI_Hs01_00169457 predicted 562
5 SASI_Hs01_00169458 predicted 2581
6 SASI_Hs01_00169459 predicted 641
7 SASI_Hs01_00169461 predicted 3812
8 SASI_Hs01_00169462 predicted 3820
9 SASI_Hs02_00344349 predicted 3793
10 SASI_Hs02_00344350 predicted 2427
11 SASI_Hs01_00169454 predicted 3753
12 SASI_Hs01_00169455 predicted 241
13 SASI_Hs01_00169460 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034222 predicted 2834
2 SASI_Rn02_00266498 predicted 2545
3 SASI_Rn01_00034224 predicted 3910
4 SASI_Rn02_00266499 predicted 437
5 SASI_Rn01_00034226 predicted 1165
6 SASI_Rn02_00266500 predicted 3057
7 SASI_Rn01_00034228 predicted 2826
8 SASI_Rn01_00034229 predicted 1108
9 SASI_Rn01_00034230 predicted 2367
10 SASI_Rn02_00266501 predicted 2138
11 SASI_Rn01_00034223 predicted 236
12 SASI_Rn01_00034225 predicted 886
13 SASI_Rn01_00034227 predicted 326
14 SASI_Rn01_00034231 predicted 2979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065911 predicted 479
2 SASI_Mm01_00065912 predicted 344
3 SASI_Mm01_00065913 predicted 660
4 SASI_Mm01_00065914 predicted 790
5 SASI_Mm01_00065915 predicted 2465
6 SASI_Mm01_00065916 predicted 984
7 SASI_Mm02_00323815 predicted 2468
8 SASI_Mm01_00065917 predicted 1210
9 SASI_Mm01_00065918 predicted 1170
10 SASI_Mm01_00065919 predicted 425
11 SASI_Mm01_00065920 predicted 1585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012447
VALIDATED
STAG3 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-567s21c1
Sequence:CCGGATCCAATCTTGCGGATGTAAACTCGAGTTTACATCCGCAAGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2566s21c1
Sequence:CCGGGTGATCTACTTCTCATCTTTACTCGAGTAAAGATGAGAAGTAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-642s21c1
Sequence:GTACCGGCACCTAACAGAGCAGTTTAATCTCGAGATTAAACTGCTCTGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2720s21c1
Sequence:CCGGTGATTCCCAGGAGGATCATTTCTCGAGAAATGATCCTCCTGGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2153s21c1
Sequence:CCGGCCGCAGCCAGCTAGTAGATTTCTCGAGAAATCTACTAGCTGGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_012447.1-1243s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-1118s1c1
Sequence:CCGGCAAGAGCATCAAGAGGAGATTCTCGAGAATCTCCTCTTGATGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012447.1-2819s1c1
Sequence:CCGGCAGGAGGATCATTTACAGATACTCGAGTATCTGTAAATGATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012447.1-383s1c1
Sequence:CCGGGCTGATGAAGACACTGACTTTCTCGAGAAAGTCAGTGTCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012447.1-629s1c1
Sequence:CCGGGCAGGATTTCTGGAGCTTGTTCTCGAGAACAAGCTCCAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-2702s1c1
Sequence:CCGGCGTGATTTCCTTAGGCCACTTCTCGAGAAGTGGCCTAAGGAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-658s1c1
Sequence:CCGGCATCCAATCTTGCGGATGTAACTCGAGTTACATCCGCAAGATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012447.1-1463s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012447.1-2477s1c1
Sequence:CCGGCCAGCCTTGACTCTTGTCTATCTCGAGATAGACAAGAGTCAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012447
VALIDATED
STAG3 MISSION shRNA shRNA Plasmid DNA
stromal antigen 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-567s21c1
Sequence:CCGGATCCAATCTTGCGGATGTAAACTCGAGTTTACATCCGCAAGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2566s21c1
Sequence:CCGGGTGATCTACTTCTCATCTTTACTCGAGTAAAGATGAGAAGTAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-642s21c1
Sequence:GTACCGGCACCTAACAGAGCAGTTTAATCTCGAGATTAAACTGCTCTGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2720s21c1
Sequence:CCGGTGATTCCCAGGAGGATCATTTCTCGAGAAATGATCCTCCTGGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2153s21c1
Sequence:CCGGCCGCAGCCAGCTAGTAGATTTCTCGAGAAATCTACTAGCTGGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_012447.1-1243s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-1118s1c1
Sequence:CCGGCAAGAGCATCAAGAGGAGATTCTCGAGAATCTCCTCTTGATGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012447.1-2819s1c1
Sequence:CCGGCAGGAGGATCATTTACAGATACTCGAGTATCTGTAAATGATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012447.1-383s1c1
Sequence:CCGGGCTGATGAAGACACTGACTTTCTCGAGAAAGTCAGTGTCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012447.1-629s1c1
Sequence:CCGGGCAGGATTTCTGGAGCTTGTTCTCGAGAACAAGCTCCAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-2702s1c1
Sequence:CCGGCGTGATTTCCTTAGGCCACTTCTCGAGAAGTGGCCTAAGGAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-658s1c1
Sequence:CCGGCATCCAATCTTGCGGATGTAACTCGAGTTACATCCGCAAGATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012447.1-1463s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012447.1-2477s1c1
Sequence:CCGGCCAGCCTTGACTCTTGTCTATCTCGAGATAGACAAGAGTCAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012447
VALIDATED
STAG3 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-567s21c1
Sequence:CCGGATCCAATCTTGCGGATGTAAACTCGAGTTTACATCCGCAAGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2566s21c1
Sequence:CCGGGTGATCTACTTCTCATCTTTACTCGAGTAAAGATGAGAAGTAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-642s21c1
Sequence:GTACCGGCACCTAACAGAGCAGTTTAATCTCGAGATTAAACTGCTCTGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2720s21c1
Sequence:CCGGTGATTCCCAGGAGGATCATTTCTCGAGAAATGATCCTCCTGGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012447.2-2153s21c1
Sequence:CCGGCCGCAGCCAGCTAGTAGATTTCTCGAGAAATCTACTAGCTGGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_012447.1-1243s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-1118s1c1
Sequence:CCGGCAAGAGCATCAAGAGGAGATTCTCGAGAATCTCCTCTTGATGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012447.1-2819s1c1
Sequence:CCGGCAGGAGGATCATTTACAGATACTCGAGTATCTGTAAATGATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012447.1-383s1c1
Sequence:CCGGGCTGATGAAGACACTGACTTTCTCGAGAAAGTCAGTGTCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012447.1-629s1c1
Sequence:CCGGGCAGGATTTCTGGAGCTTGTTCTCGAGAACAAGCTCCAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-2702s1c1
Sequence:CCGGCGTGATTTCCTTAGGCCACTTCTCGAGAAGTGGCCTAAGGAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012447.1-658s1c1
Sequence:CCGGCATCCAATCTTGCGGATGTAACTCGAGTTACATCCGCAAGATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012447.1-1463s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012447.1-2477s1c1
Sequence:CCGGCCAGCCTTGACTCTTGTCTATCTCGAGATAGACAAGAGTCAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016964
STAG3 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-335s21c1
Sequence:CCGGCTAACGAAGACAGCGACTTTGCTCGAGCAAAGTCGCTGTCTTCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-688s21c1
Sequence:GTACCGGCACCTAACGGAAGAGTTTAATCTCGAGATTAAACTCTTCCGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016964.2-4072s21c1
Sequence:CCGGCTTAATGCGCCATCGCTTTATCTCGAGATAAAGCGATGGCGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-2433s21c1
Sequence:CCGGAGCCTTGACTCTGGTATATTTCTCGAGAAATATACCAGAGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-543s21c1
Sequence:CCGGGGTGGATGAGTGGCTAGATAACTCGAGTTATCTAGCCACTCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016964.1-3984s1c1
Sequence:CCGGCTTTCTGAAGTGGGTGCTATACTCGAGTATAGCACCCACTTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-2432s1c1
Sequence:CCGGCCCACATTTCAGAGTCTACTTCTCGAGAAGTAGACTCTGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-403s1c1
Sequence:CCGGCGAATAGTATCTAGTGGGAATCTCGAGATTCCCACTAGATACTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-882s1c1
Sequence:CCGGGCTAATGACTTCTCTGGTAAACTCGAGTTTACCAGAGAAGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-402s1c1
Sequence:CCGGCCGAATAGTATCTAGTGGGAACTCGAGTTCCCACTAGATACTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016964
STAG3 MISSION shRNA shRNA Plasmid DNA
stromal antigen 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-335s21c1
Sequence:CCGGCTAACGAAGACAGCGACTTTGCTCGAGCAAAGTCGCTGTCTTCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-688s21c1
Sequence:GTACCGGCACCTAACGGAAGAGTTTAATCTCGAGATTAAACTCTTCCGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016964.2-4072s21c1
Sequence:CCGGCTTAATGCGCCATCGCTTTATCTCGAGATAAAGCGATGGCGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-2433s21c1
Sequence:CCGGAGCCTTGACTCTGGTATATTTCTCGAGAAATATACCAGAGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-543s21c1
Sequence:CCGGGGTGGATGAGTGGCTAGATAACTCGAGTTATCTAGCCACTCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016964.1-3984s1c1
Sequence:CCGGCTTTCTGAAGTGGGTGCTATACTCGAGTATAGCACCCACTTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-2432s1c1
Sequence:CCGGCCCACATTTCAGAGTCTACTTCTCGAGAAGTAGACTCTGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-403s1c1
Sequence:CCGGCGAATAGTATCTAGTGGGAATCTCGAGATTCCCACTAGATACTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-882s1c1
Sequence:CCGGGCTAATGACTTCTCTGGTAAACTCGAGTTTACCAGAGAAGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-402s1c1
Sequence:CCGGCCGAATAGTATCTAGTGGGAACTCGAGTTCCCACTAGATACTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016964
STAG3 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-335s21c1
Sequence:CCGGCTAACGAAGACAGCGACTTTGCTCGAGCAAAGTCGCTGTCTTCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-688s21c1
Sequence:GTACCGGCACCTAACGGAAGAGTTTAATCTCGAGATTAAACTCTTCCGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016964.2-4072s21c1
Sequence:CCGGCTTAATGCGCCATCGCTTTATCTCGAGATAAAGCGATGGCGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-2433s21c1
Sequence:CCGGAGCCTTGACTCTGGTATATTTCTCGAGAAATATACCAGAGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016964.2-543s21c1
Sequence:CCGGGGTGGATGAGTGGCTAGATAACTCGAGTTATCTAGCCACTCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016964.1-3984s1c1
Sequence:CCGGCTTTCTGAAGTGGGTGCTATACTCGAGTATAGCACCCACTTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-2432s1c1
Sequence:CCGGCCCACATTTCAGAGTCTACTTCTCGAGAAGTAGACTCTGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-403s1c1
Sequence:CCGGCGAATAGTATCTAGTGGGAATCTCGAGATTCCCACTAGATACTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-882s1c1
Sequence:CCGGGCTAATGACTTCTCTGGTAAACTCGAGTTTACCAGAGAAGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016964.1-402s1c1
Sequence:CCGGCCGAATAGTATCTAGTGGGAACTCGAGTTCCCACTAGATACTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks