EMAIL THIS PAGE TO A FRIEND

STAG3L1

stromal antigen 3-like 1 (pseudogene)

Synonyms: STAG3L1P STAG3L2 STAG3L3
Species: Human STAG3L1(54441)
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002840 Rosetta Predictions human pricing
NM_018991 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106591 predicted 956
2 SASI_Hs01_00106592 predicted 944
3 SASI_Hs01_00106593 predicted 954
4 SASI_Hs01_00106594 predicted 962
5 SASI_Hs01_00106595 predicted 882
6 SASI_Hs01_00106588 predicted 777
7 SASI_Hs01_00106589 predicted 530
8 SASI_Hs01_00106590 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105269 predicted 663
2 SASI_Hs01_00105270 predicted 1083
3 SASI_Hs01_00105268 predicted 650
4 SASI_Hs01_00105271 predicted 1068
5 SASI_Hs01_00105272 predicted 1086
6 SASI_Hs01_00105273 predicted 1081
7 SASI_Hs01_00105274 predicted 1010
8 SASI_Hs01_00105267 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018991
VALIDATED
STAG3L1 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 3-like 1 (pseudogene)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018991.2-1377s1c1
Sequence:CCGGGCCCAGCATGTTAGACAATTTCTCGAGAAATTGTCTAACATGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018991.2-865s1c1
Sequence:CCGGCGCTGCTTACTTAGTAGACAACTCGAGTTGTCTACTAAGTAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-458s1c1
Sequence:CCGGGCTATCTGCATTGAGGAAATTCTCGAGAATTTCCTCAATGCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-490s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-710s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018991.2-1376s21c1
Sequence:CCGGCGCCCAGCATGTTAGACAATTCTCGAGAATTGTCTAACATGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018991.2-721s21c1
Sequence:CCGGACTGATACTTATCCTTAAACTCTCGAGAGTTTAAGGATAAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018991
VALIDATED
STAG3L1 MISSION shRNA shRNA Plasmid DNA
stromal antigen 3-like 1 (pseudogene)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018991.2-1377s1c1
Sequence:CCGGGCCCAGCATGTTAGACAATTTCTCGAGAAATTGTCTAACATGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018991.2-865s1c1
Sequence:CCGGCGCTGCTTACTTAGTAGACAACTCGAGTTGTCTACTAAGTAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-458s1c1
Sequence:CCGGGCTATCTGCATTGAGGAAATTCTCGAGAATTTCCTCAATGCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-490s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-710s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018991.2-1376s21c1
Sequence:CCGGCGCCCAGCATGTTAGACAATTCTCGAGAATTGTCTAACATGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018991.2-721s21c1
Sequence:CCGGACTGATACTTATCCTTAAACTCTCGAGAGTTTAAGGATAAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018991
VALIDATED
STAG3L1 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 3-like 1 (pseudogene)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018991.2-1377s1c1
Sequence:CCGGGCCCAGCATGTTAGACAATTTCTCGAGAAATTGTCTAACATGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018991.2-865s1c1
Sequence:CCGGCGCTGCTTACTTAGTAGACAACTCGAGTTGTCTACTAAGTAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-458s1c1
Sequence:CCGGGCTATCTGCATTGAGGAAATTCTCGAGAATTTCCTCAATGCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-490s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018991.2-710s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018991.2-1376s21c1
Sequence:CCGGCGCCCAGCATGTTAGACAATTCTCGAGAATTGTCTAACATGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018991.2-721s21c1
Sequence:CCGGACTGATACTTATCCTTAAACTCTCGAGAGTTTAAGGATAAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks