EMAIL THIS PAGE TO A FRIEND

STAG3L3

stromal antigen 3-like 3

Synonyms: STAG3L1 STAG3L2
Species: Human STAG3L3(442578)
Gene ID:
8 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013739 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013739 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306488 predicted 755
2 SASI_Hs01_00056295 predicted 696
3 SASI_Hs01_00056296 predicted 903
4 SASI_Hs01_00056294 predicted 774
5 SASI_Hs01_00056297 predicted 936
6 SASI_Hs01_00056298 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013739
STAG3L3 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 3-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-579s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013739.1-826s1c1
Sequence:CCGGGCAAGGTGACATACACAGAGACTCGAGTCTCTGTGTATGTCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-417s1c1
Sequence:CCGGCTGCATGATAAGCACCGAGAACTCGAGTTCTCGGTGCTTATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-798s1c1
Sequence:CCGGCAGCTTCTGCTGTCCTTCTTTCTCGAGAAAGAAGGACAGCAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-318s1c1
Sequence:CCGGGAGATCCGTGCTATCTGCATTCTCGAGAATGCAGATAGCACGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013739.1-783s1c1
Sequence:CCGGCAGAGGACTTTCTTCCAGCTTCTCGAGAAGCTGGAAGAAAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-827s1c1
Sequence:CCGGCAAGGTGACATACACAGAGATCTCGAGATCTCTGTGTATGTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-537s1c1
Sequence:CCGGGTTTCCATGATCATGGACAGACTCGAGTCTGTCCATGATCATGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-359s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-380s1c1
Sequence:CCGGCCTCACCGACAGCTATTTAAACTCGAGTTTAAATAGCTGTCGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013739
STAG3L3 MISSION shRNA shRNA Plasmid DNA
stromal antigen 3-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-579s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013739.1-826s1c1
Sequence:CCGGGCAAGGTGACATACACAGAGACTCGAGTCTCTGTGTATGTCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-417s1c1
Sequence:CCGGCTGCATGATAAGCACCGAGAACTCGAGTTCTCGGTGCTTATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-798s1c1
Sequence:CCGGCAGCTTCTGCTGTCCTTCTTTCTCGAGAAAGAAGGACAGCAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-318s1c1
Sequence:CCGGGAGATCCGTGCTATCTGCATTCTCGAGAATGCAGATAGCACGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013739.1-783s1c1
Sequence:CCGGCAGAGGACTTTCTTCCAGCTTCTCGAGAAGCTGGAAGAAAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-827s1c1
Sequence:CCGGCAAGGTGACATACACAGAGATCTCGAGATCTCTGTGTATGTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-537s1c1
Sequence:CCGGGTTTCCATGATCATGGACAGACTCGAGTCTGTCCATGATCATGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-359s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-380s1c1
Sequence:CCGGCCTCACCGACAGCTATTTAAACTCGAGTTTAAATAGCTGTCGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013739
STAG3L3 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 3-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-579s1c1
Sequence:CCGGGCCGTCAGATTACTGATACTTCTCGAGAAGTATCAGTAATCTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013739.1-826s1c1
Sequence:CCGGGCAAGGTGACATACACAGAGACTCGAGTCTCTGTGTATGTCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-417s1c1
Sequence:CCGGCTGCATGATAAGCACCGAGAACTCGAGTTCTCGGTGCTTATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-798s1c1
Sequence:CCGGCAGCTTCTGCTGTCCTTCTTTCTCGAGAAAGAAGGACAGCAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-318s1c1
Sequence:CCGGGAGATCCGTGCTATCTGCATTCTCGAGAATGCAGATAGCACGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013739.1-783s1c1
Sequence:CCGGCAGAGGACTTTCTTCCAGCTTCTCGAGAAGCTGGAAGAAAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-827s1c1
Sequence:CCGGCAAGGTGACATACACAGAGATCTCGAGATCTCTGTGTATGTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-537s1c1
Sequence:CCGGGTTTCCATGATCATGGACAGACTCGAGTCTGTCCATGATCATGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013739.1-359s1c1
Sequence:CCGGGCAAAGCTACAGCACGTCTTTCTCGAGAAAGACGTGCTGTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013739.1-380s1c1
Sequence:CCGGCCTCACCGACAGCTATTTAAACTCGAGTTTAAATAGCTGTCGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks