EMAIL THIS PAGE TO A FRIEND

STAG3L4

stromal antigen 3-like 4 (pseudogene)

Synonyms: STAG3L4P
Species: Human STAG3L4(64940)
UniProtKB ID: Q8TBR4, Q9H8W0
Gene ID:
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022906 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110261 MISSION® esiRNA esiRNA human STAG3L4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022906 Rosetta Predictions human pricing
XM_498429 Rosetta Predictions human pricing
XM_927274 Rosetta Predictions human pricing
XM_931972 Rosetta Predictions human pricing
XM_931976 Rosetta Predictions human pricing
XM_931982 Rosetta Predictions human pricing
XM_931985 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356213 predicted 746
2 SASI_Hs02_00356214 predicted 981
3 SASI_Hs02_00356215 predicted 891
4 SASI_Hs02_00356216 predicted 938
5 SASI_Hs02_00356217 predicted 941
6 SASI_Hs02_00356218 predicted 744
7 SASI_Hs02_00356219 predicted 706
8 SASI_Hs02_00356220 predicted 813
9 SASI_Hs02_00356221 predicted 696
10 SASI_Hs02_00356222 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269528 predicted 728
2 SASI_Hs01_00269529 predicted 702
3 SASI_Hs01_00269530 predicted 591
4 SASI_Hs01_00269531 predicted 732
5 SASI_Hs01_00269532 predicted 704
6 SASI_Hs01_00269533 predicted 685
7 SASI_Hs01_00269534 predicted 591
8 SASI_Hs01_00269535 predicted 697
9 SASI_Hs01_00269536 predicted 732
10 SASI_Hs01_00269537 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271939 predicted 811
2 SASI_Hs01_00271940 predicted 873
3 SASI_Hs01_00271941 predicted 843
4 SASI_Hs01_00271942 predicted 822
5 SASI_Hs01_00271943 predicted 443
6 SASI_Hs01_00271944 predicted 445
7 SASI_Hs01_00271945 predicted 874
8 SASI_Hs01_00271946 predicted 874
9 SASI_Hs01_00271947 predicted 884
10 SASI_Hs01_00271948 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289568 predicted 851
2 SASI_Hs01_00289569 predicted 816
3 SASI_Hs01_00289570 predicted 711
4 SASI_Hs01_00289571 predicted 861
5 SASI_Hs01_00289572 predicted 826
6 SASI_Hs01_00289573 predicted 808
7 SASI_Hs01_00289574 predicted 713
8 SASI_Hs01_00289575 predicted 814
9 SASI_Hs01_00289576 predicted 848
10 SASI_Hs01_00289577 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266117 predicted 928
2 SASI_Hs01_00266118 predicted 901
3 SASI_Hs01_00266119 predicted 786
4 SASI_Hs01_00266120 predicted 930
5 SASI_Hs01_00266121 predicted 901
6 SASI_Hs01_00266122 predicted 881
7 SASI_Hs01_00266123 predicted 791
8 SASI_Hs01_00266124 predicted 893
9 SASI_Hs01_00266125 predicted 924
10 SASI_Hs01_00266126 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266388 predicted 569
2 SASI_Hs01_00266389 predicted 536
3 SASI_Hs01_00266390 predicted 426
4 SASI_Hs01_00266391 predicted 572
5 SASI_Hs01_00266392 predicted 540
6 SASI_Hs01_00266393 predicted 530
7 SASI_Hs01_00266394 predicted 430
8 SASI_Hs01_00266395 predicted 532
9 SASI_Hs01_00266396 predicted 574
10 SASI_Hs01_00266397 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275432 predicted 639
2 SASI_Hs01_00275433 predicted 597
3 SASI_Hs01_00275434 predicted 493
4 SASI_Hs01_00275435 predicted 635
5 SASI_Hs01_00275436 predicted 602
6 SASI_Hs01_00275437 predicted 589
7 SASI_Hs01_00275438 predicted 489
8 SASI_Hs01_00275439 predicted 601
9 SASI_Hs01_00275440 predicted 634
10 SASI_Hs01_00275441 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022906
VALIDATED
STAG3L4 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 3-like 4 (pseudogene)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-583s1c1
Sequence:CCGGCAACTGAGTCTGCACCAAGATCTCGAGATCTTGGTGCAGACTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-447s1c1
Sequence:CCGGCCTCCATGATGACTTCCCTATCTCGAGATAGGGAAGTCATCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-285s1c1
Sequence:CCGGGATGCAGGATTTCTGGAGCTTCTCGAGAAGCTCCAGAAATCCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-317s1c1
Sequence:CCGGCATCTGATCTTGTGGATGTAACTCGAGTTACATCCACAAGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-601s1c1
Sequence:CCGGGATATCAATCAGCGTCAGTATCTCGAGATACTGACGCTGATTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022906.1-1446s1c1
Sequence:CCGGGCTCATTAGTAATCCATCATTCTCGAGAATGATGGATTACTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-1816s1c1
Sequence:CCGGGCTGCTTAATCATACGTCAAACTCGAGTTTGACGTATGATTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-436s1c1
Sequence:CCGGCAGTACATCCTCCTCCATGATCTCGAGATCATGGAGGAGGATGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-722s21c1
Sequence:CCGGACTACATTGTCAAAGACAAAGCTCGAGCTTTGTCTTTGACAATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1179s21c1
Sequence:CCGGTTACTACCACTTCACAATTTACTCGAGTAAATTGTGAAGTGGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1072s21c1
Sequence:CCGGGCCATAGACACCATTACTATCCTCGAGGATAGTAATGGTGTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-884s21c1
Sequence:CCGGAGTACTCTGCAAGGCTAATTACTCGAGTAATTAGCCTTGCAGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-897s21c1
Sequence:CCGGGCTAATTAGGACAGATCAATGCTCGAGCATTGATCTGTCCTAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1086s21c1
Sequence:CCGGTACTATCACGTAGGCTCATAGCTCGAGCTATGAGCCTACGTGATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-941s21c1
Sequence:CCGGGAAAGGTGTGTAGTGACTATGCTCGAGCATAGTCACTACACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022906.2-605s21c1
Sequence:CCGGGTCTGCACGAAGATATCAATCCTCGAGGATTGATATCTTCGTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022906
VALIDATED
STAG3L4 MISSION shRNA shRNA Plasmid DNA
stromal antigen 3-like 4 (pseudogene)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-583s1c1
Sequence:CCGGCAACTGAGTCTGCACCAAGATCTCGAGATCTTGGTGCAGACTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-447s1c1
Sequence:CCGGCCTCCATGATGACTTCCCTATCTCGAGATAGGGAAGTCATCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-285s1c1
Sequence:CCGGGATGCAGGATTTCTGGAGCTTCTCGAGAAGCTCCAGAAATCCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-317s1c1
Sequence:CCGGCATCTGATCTTGTGGATGTAACTCGAGTTACATCCACAAGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-601s1c1
Sequence:CCGGGATATCAATCAGCGTCAGTATCTCGAGATACTGACGCTGATTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022906.1-1446s1c1
Sequence:CCGGGCTCATTAGTAATCCATCATTCTCGAGAATGATGGATTACTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-1816s1c1
Sequence:CCGGGCTGCTTAATCATACGTCAAACTCGAGTTTGACGTATGATTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-436s1c1
Sequence:CCGGCAGTACATCCTCCTCCATGATCTCGAGATCATGGAGGAGGATGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-722s21c1
Sequence:CCGGACTACATTGTCAAAGACAAAGCTCGAGCTTTGTCTTTGACAATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1179s21c1
Sequence:CCGGTTACTACCACTTCACAATTTACTCGAGTAAATTGTGAAGTGGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1072s21c1
Sequence:CCGGGCCATAGACACCATTACTATCCTCGAGGATAGTAATGGTGTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-884s21c1
Sequence:CCGGAGTACTCTGCAAGGCTAATTACTCGAGTAATTAGCCTTGCAGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-897s21c1
Sequence:CCGGGCTAATTAGGACAGATCAATGCTCGAGCATTGATCTGTCCTAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1086s21c1
Sequence:CCGGTACTATCACGTAGGCTCATAGCTCGAGCTATGAGCCTACGTGATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-941s21c1
Sequence:CCGGGAAAGGTGTGTAGTGACTATGCTCGAGCATAGTCACTACACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022906.2-605s21c1
Sequence:CCGGGTCTGCACGAAGATATCAATCCTCGAGGATTGATATCTTCGTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022906
VALIDATED
STAG3L4 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 3-like 4 (pseudogene)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-583s1c1
Sequence:CCGGCAACTGAGTCTGCACCAAGATCTCGAGATCTTGGTGCAGACTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-447s1c1
Sequence:CCGGCCTCCATGATGACTTCCCTATCTCGAGATAGGGAAGTCATCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-285s1c1
Sequence:CCGGGATGCAGGATTTCTGGAGCTTCTCGAGAAGCTCCAGAAATCCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-317s1c1
Sequence:CCGGCATCTGATCTTGTGGATGTAACTCGAGTTACATCCACAAGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-601s1c1
Sequence:CCGGGATATCAATCAGCGTCAGTATCTCGAGATACTGACGCTGATTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022906.1-1446s1c1
Sequence:CCGGGCTCATTAGTAATCCATCATTCTCGAGAATGATGGATTACTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022906.1-1816s1c1
Sequence:CCGGGCTGCTTAATCATACGTCAAACTCGAGTTTGACGTATGATTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022906.1-436s1c1
Sequence:CCGGCAGTACATCCTCCTCCATGATCTCGAGATCATGGAGGAGGATGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-722s21c1
Sequence:CCGGACTACATTGTCAAAGACAAAGCTCGAGCTTTGTCTTTGACAATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1179s21c1
Sequence:CCGGTTACTACCACTTCACAATTTACTCGAGTAAATTGTGAAGTGGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1072s21c1
Sequence:CCGGGCCATAGACACCATTACTATCCTCGAGGATAGTAATGGTGTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-884s21c1
Sequence:CCGGAGTACTCTGCAAGGCTAATTACTCGAGTAATTAGCCTTGCAGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-897s21c1
Sequence:CCGGGCTAATTAGGACAGATCAATGCTCGAGCATTGATCTGTCCTAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-1086s21c1
Sequence:CCGGTACTATCACGTAGGCTCATAGCTCGAGCTATGAGCCTACGTGATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022906.2-941s21c1
Sequence:CCGGGAAAGGTGTGTAGTGACTATGCTCGAGCATAGTCACTACACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022906.2-605s21c1
Sequence:CCGGGTCTGCACGAAGATATCAATCCTCGAGGATTGATATCTTCGTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks