EMAIL THIS PAGE TO A FRIEND

STAM2

signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

Synonyms: Hbp STAM2A STAM2B
UniProtKB ID: O75886, A8K8A0, D3DPA1, Q7LDQ0, Q9UF58
Gene ID:
Human(10254) Summary: The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]
Mouse(56324) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Rat(311030) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Zebrafish(492497) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
chicken(424317) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Horse(100057966) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
domestic cat(101080562) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
dog(476150) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
naked mole-rat(101722782) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Domestic Rabbit(100351322) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
domestic guinea pig(100727167) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
cow(538505) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
sheep(101117649) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005843 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004541 MISSION® esiRNA esiRNA targeting human STAM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005843 Rosetta Predictions human pricing
NM_001012085 Rosetta Predictions rat pricing
XM_575133 Rosetta Predictions rat pricing
NM_019667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138144 predicted 1522
2 SASI_Hs01_00138147 predicted 1448
3 SASI_Hs02_00340382 predicted 915
4 SASI_Hs01_00138148 predicted 439
5 SASI_Hs01_00138150 predicted 461
6 SASI_Hs01_00138151 predicted 1826
7 SASI_Hs01_00138152 predicted 1682
8 SASI_Hs02_00340383 predicted 1791
9 SASI_Hs01_00138153 predicted 1260
10 SASI_Hs02_00340384 predicted 723
11 SASI_Hs01_00138145 predicted 1364
12 SASI_Hs01_00138146 predicted 962
13 SASI_Hs01_00138149 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200215 predicted 327
2 SASI_Rn01_00036376 predicted 863
3 SASI_Rn01_00036377 predicted 268
4 SASI_Rn01_00036378 predicted 716
5 SASI_Rn01_00036379 predicted 910
6 SASI_Rn01_00036380 predicted 767
7 SASI_Rn01_00036381 predicted 970
8 SASI_Rn01_00036382 predicted 484
9 SASI_Rn01_00036383 predicted 914
10 SASI_Rn01_00036384 predicted 280
11 SASI_Rn01_00036385 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163010 predicted 1767
2 SASI_Rn01_00163011 predicted 1808
3 SASI_Rn01_00163012 predicted 1778
4 SASI_Rn01_00163013 predicted 1914
5 SASI_Rn01_00163014 predicted 1903
6 SASI_Rn01_00163015 predicted 1934
7 SASI_Rn01_00163016 predicted 1832
8 SASI_Rn01_00163017 predicted 1866
9 SASI_Rn01_00163018 predicted 1774
10 SASI_Rn01_00163019 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094963 predicted 943
2 SASI_Mm01_00094964 predicted 1340
3 SASI_Mm02_00324730 predicted 1320
4 SASI_Mm01_00094965 predicted 275
5 SASI_Mm01_00094966 predicted 1002
6 SASI_Mm01_00094967 predicted 543
7 SASI_Mm01_00094968 predicted 436
8 SASI_Mm01_00094969 predicted 1148
9 SASI_Mm01_00094970 predicted 428
10 SASI_Mm01_00094971 predicted 1303
11 SASI_Mm01_00094972 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005843
VALIDATED
STAM2 MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-960s1c1
Sequence:CCGGGCACGGAAAGTGAGAGCTTTACTCGAGTAAAGCTCTCACTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005843.3-1699s1c1
Sequence:CCGGGCACTGGACAAGACACTGTTTCTCGAGAAACAGTGTCTTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-415s1c1
Sequence:CCGGCTACAGAAGATTGGAGTCTTACTCGAGTAAGACTCCAATCTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-1676s1c1
Sequence:CCGGGCCTGCTCAAACTTCATATTTCTCGAGAAATATGAAGTTTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-1452s1c1
Sequence:CCGGGCACCAGTGTACTCAGTCTATCTCGAGATAGACTGAGTACACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005843.4-624s21c1
Sequence:GTACCGGGAAGTACGTGCTGTGATTAAACTCGAGTTTAATCACAGCACGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005843
VALIDATED
STAM2 MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-960s1c1
Sequence:CCGGGCACGGAAAGTGAGAGCTTTACTCGAGTAAAGCTCTCACTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005843.3-1699s1c1
Sequence:CCGGGCACTGGACAAGACACTGTTTCTCGAGAAACAGTGTCTTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-415s1c1
Sequence:CCGGCTACAGAAGATTGGAGTCTTACTCGAGTAAGACTCCAATCTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-1676s1c1
Sequence:CCGGGCCTGCTCAAACTTCATATTTCTCGAGAAATATGAAGTTTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-1452s1c1
Sequence:CCGGGCACCAGTGTACTCAGTCTATCTCGAGATAGACTGAGTACACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005843.4-624s21c1
Sequence:GTACCGGGAAGTACGTGCTGTGATTAAACTCGAGTTTAATCACAGCACGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005843
VALIDATED
STAM2 MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-960s1c1
Sequence:CCGGGCACGGAAAGTGAGAGCTTTACTCGAGTAAAGCTCTCACTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005843.3-1699s1c1
Sequence:CCGGGCACTGGACAAGACACTGTTTCTCGAGAAACAGTGTCTTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-415s1c1
Sequence:CCGGCTACAGAAGATTGGAGTCTTACTCGAGTAAGACTCCAATCTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-1676s1c1
Sequence:CCGGGCCTGCTCAAACTTCATATTTCTCGAGAAATATGAAGTTTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005843.3-1452s1c1
Sequence:CCGGGCACCAGTGTACTCAGTCTATCTCGAGATAGACTGAGTACACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005843.4-624s21c1
Sequence:GTACCGGGAAGTACGTGCTGTGATTAAACTCGAGTTTAATCACAGCACGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019667
VALIDATED
STAM2 MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-852s1c1
Sequence:CCGGCGGTGGACAAATTGAATGTAACTCGAGTTACATTCAATTTGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-321s1c1
Sequence:CCGGCGGAAGTACGTTCTGTGATAACTCGAGTTATCACAGAACGTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019667.2-668s1c1
Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-1151s1c1
Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019667.2-1371s1c1
Sequence:CCGGCCGTCCAACCTCCATACTTAACTCGAGTTAAGTATGGAGGTTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-295s21c1
Sequence:CCGGAGAAGTATGTTCCCGTGATTTCTCGAGAAATCACGGGAACATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-1151s21c1
Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019667.2-2066s21c1
Sequence:CCGGTTTAGCTTGCCAGCATATTTCCTCGAGGAAATATGCTGGCAAGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-428s21c1
Sequence:CCGGAGTCTGATATCTGCAACTATTCTCGAGAATAGTTGCAGATATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-668s21c1
Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019667
VALIDATED
STAM2 MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-852s1c1
Sequence:CCGGCGGTGGACAAATTGAATGTAACTCGAGTTACATTCAATTTGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-321s1c1
Sequence:CCGGCGGAAGTACGTTCTGTGATAACTCGAGTTATCACAGAACGTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019667.2-668s1c1
Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-1151s1c1
Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019667.2-1371s1c1
Sequence:CCGGCCGTCCAACCTCCATACTTAACTCGAGTTAAGTATGGAGGTTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-295s21c1
Sequence:CCGGAGAAGTATGTTCCCGTGATTTCTCGAGAAATCACGGGAACATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-1151s21c1
Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019667.2-2066s21c1
Sequence:CCGGTTTAGCTTGCCAGCATATTTCCTCGAGGAAATATGCTGGCAAGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-428s21c1
Sequence:CCGGAGTCTGATATCTGCAACTATTCTCGAGAATAGTTGCAGATATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-668s21c1
Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019667
VALIDATED
STAM2 MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-852s1c1
Sequence:CCGGCGGTGGACAAATTGAATGTAACTCGAGTTACATTCAATTTGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-321s1c1
Sequence:CCGGCGGAAGTACGTTCTGTGATAACTCGAGTTATCACAGAACGTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019667.2-668s1c1
Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019667.2-1151s1c1
Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019667.2-1371s1c1
Sequence:CCGGCCGTCCAACCTCCATACTTAACTCGAGTTAAGTATGGAGGTTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-295s21c1
Sequence:CCGGAGAAGTATGTTCCCGTGATTTCTCGAGAAATCACGGGAACATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-1151s21c1
Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019667.2-2066s21c1
Sequence:CCGGTTTAGCTTGCCAGCATATTTCCTCGAGGAAATATGCTGGCAAGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-428s21c1
Sequence:CCGGAGTCTGATATCTGCAACTATTCTCGAGAATAGTTGCAGATATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019667.2-668s21c1
Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks