EMAIL THIS PAGE TO A FRIEND

STAM

signal transducing adaptor molecule (SH3 domain and ITAM motif) 1

Synonyms: STAM-1 STAM1
UniProtKB ID: Q92783, B0YJ99, D3DRU5, Q8N6D9
Gene ID:
Human(8027) Summary: This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(20844) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Rat(498798) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
fruit fly(34505) Signal transducing adaptor molecule
Zebrafish(386967) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
chicken(420517) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Horse(100068325) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
domestic cat(101092504) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
dog(477990) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
cow(512734) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
sheep(101111214) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
domestic guinea pig(100723599) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Domestic Rabbit(100346128) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
naked mole-rat(101717932) signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003473 Rosetta Predictions human pricing
NM_001109121 Rosetta Predictions rat pricing
NM_011484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036476 predicted 595
2 SASI_Hs01_00036477 predicted 1369
3 SASI_Hs02_00335732 predicted 1048
4 SASI_Hs01_00036478 predicted 1316
5 SASI_Hs01_00036479 predicted 392
6 SASI_Hs01_00036481 predicted 1335
7 SASI_Hs01_00036482 predicted 588
8 SASI_Hs02_00335733 predicted 817
9 SASI_Hs01_00036483 predicted 967
10 SASI_Hs01_00036484 predicted 485
11 SASI_Hs01_00036480 predicted 309
12 SASI_Hs01_00036485 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245330 predicted 648
2 SASI_Rn02_00245331 predicted 1078
3 SASI_Rn02_00245332 predicted 290
4 SASI_Rn02_00245333 predicted 385
5 SASI_Rn02_00245334 predicted 1051
6 SASI_Rn02_00245335 predicted 485
7 SASI_Rn02_00245336 predicted 737
8 SASI_Rn02_00245337 predicted 1856
9 SASI_Rn02_00245338 predicted 520
10 SASI_Rn02_00245339 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320763 predicted 850
2 SASI_Mm02_00320764 predicted 222
3 SASI_Mm02_00320765 predicted 420
4 SASI_Mm02_00320766 predicted 573
5 SASI_Mm02_00320767 predicted 452
6 SASI_Mm02_00320768 predicted 439
7 SASI_Mm02_00320769 predicted 1286
8 SASI_Mm02_00320770 predicted 463
9 SASI_Mm02_00320771 predicted 1029
10 SASI_Mm02_00320772 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011484
VALIDATED
STAM MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-860s21c1
Sequence:GTACCGGGGATAATGAGCTTACCTTTAACTCGAGTTAAAGGTAAGCTCATTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-573s21c1
Sequence:GTACCGGGCAATGATCAAGAACCTTAAGCTCGAGCTTAAGGTTCTTGATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1683s21c1
Sequence:CCGGCCTGCTGATGTCACCATATACCTCGAGGTATATGGTGACATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-705s21c1
Sequence:CCGGGAAGATTTAGCCAAAGCTATTCTCGAGAATAGCTTTGGCTAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-1288s21c1
Sequence:CCGGTCTCACTGTATACGAAGTTAACTCGAGTTAACTTCGTATACAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011484.2-3428s21c1
Sequence:CCGGCCAGCATATTTATAGCTCTTTCTCGAGAAAGAGCTATAAATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1793s21c1
Sequence:GTACCGGTCAGCCACAGCAAGCATATTCCTCGAGGAATATGCTTGCTGTGGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1381s21c1
Sequence:GTACCGGTCTCTGCTTCCCAGGTATATCCTCGAGGATATACCTGGGAAGCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011484.2-1223s1c1
Sequence:CCGGGCTGGAAGATATTGATAGAAACTCGAGTTTCTATCAATATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011484.2-705s1c1
Sequence:CCGGGAAGATTTAGCCAAAGCTATTCTCGAGAATAGCTTTGGCTAAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011484.2-3094s1c1
Sequence:CCGGCCCTGATTGTACTATTCTATTCTCGAGAATAGAATAGTACAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011484.2-3428s1c1
Sequence:CCGGCCAGCATATTTATAGCTCTTTCTCGAGAAAGAGCTATAAATATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011484
VALIDATED
STAM MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-860s21c1
Sequence:GTACCGGGGATAATGAGCTTACCTTTAACTCGAGTTAAAGGTAAGCTCATTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-573s21c1
Sequence:GTACCGGGCAATGATCAAGAACCTTAAGCTCGAGCTTAAGGTTCTTGATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1683s21c1
Sequence:CCGGCCTGCTGATGTCACCATATACCTCGAGGTATATGGTGACATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-705s21c1
Sequence:CCGGGAAGATTTAGCCAAAGCTATTCTCGAGAATAGCTTTGGCTAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-1288s21c1
Sequence:CCGGTCTCACTGTATACGAAGTTAACTCGAGTTAACTTCGTATACAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011484.2-3428s21c1
Sequence:CCGGCCAGCATATTTATAGCTCTTTCTCGAGAAAGAGCTATAAATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1793s21c1
Sequence:GTACCGGTCAGCCACAGCAAGCATATTCCTCGAGGAATATGCTTGCTGTGGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1381s21c1
Sequence:GTACCGGTCTCTGCTTCCCAGGTATATCCTCGAGGATATACCTGGGAAGCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011484.2-1223s1c1
Sequence:CCGGGCTGGAAGATATTGATAGAAACTCGAGTTTCTATCAATATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011484.2-705s1c1
Sequence:CCGGGAAGATTTAGCCAAAGCTATTCTCGAGAATAGCTTTGGCTAAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011484.2-3094s1c1
Sequence:CCGGCCCTGATTGTACTATTCTATTCTCGAGAATAGAATAGTACAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011484.2-3428s1c1
Sequence:CCGGCCAGCATATTTATAGCTCTTTCTCGAGAAAGAGCTATAAATATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011484
VALIDATED
STAM MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-860s21c1
Sequence:GTACCGGGGATAATGAGCTTACCTTTAACTCGAGTTAAAGGTAAGCTCATTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-573s21c1
Sequence:GTACCGGGCAATGATCAAGAACCTTAAGCTCGAGCTTAAGGTTCTTGATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1683s21c1
Sequence:CCGGCCTGCTGATGTCACCATATACCTCGAGGTATATGGTGACATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-705s21c1
Sequence:CCGGGAAGATTTAGCCAAAGCTATTCTCGAGAATAGCTTTGGCTAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011484.2-1288s21c1
Sequence:CCGGTCTCACTGTATACGAAGTTAACTCGAGTTAACTTCGTATACAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011484.2-3428s21c1
Sequence:CCGGCCAGCATATTTATAGCTCTTTCTCGAGAAAGAGCTATAAATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1793s21c1
Sequence:GTACCGGTCAGCCACAGCAAGCATATTCCTCGAGGAATATGCTTGCTGTGGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011484.2-1381s21c1
Sequence:GTACCGGTCTCTGCTTCCCAGGTATATCCTCGAGGATATACCTGGGAAGCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011484.2-1223s1c1
Sequence:CCGGGCTGGAAGATATTGATAGAAACTCGAGTTTCTATCAATATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011484.2-705s1c1
Sequence:CCGGGAAGATTTAGCCAAAGCTATTCTCGAGAATAGCTTTGGCTAAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011484.2-3094s1c1
Sequence:CCGGCCCTGATTGTACTATTCTATTCTCGAGAATAGAATAGTACAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011484.2-3428s1c1
Sequence:CCGGCCAGCATATTTATAGCTCTTTCTCGAGAAAGAGCTATAAATATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003473
VALIDATED
STAM MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003473.2-1340s21c1
Sequence:GTACCGGTGAACGAAGATCCGATGTATTCTCGAGAATACATCGGATCTTCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-973s21c1
Sequence:CCGGCATCAAGGCATAGGGTTATTTCTCGAGAAATAACCCTATGCCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-488s21c1
Sequence:CCGGGTGAAGTAAGCAACGTATTAACTCGAGTTAATACGTTGCTTACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-347s21c1
Sequence:CCGGAGGATTGTCTTCGGTCTATTACTCGAGTAATAGACCGAAGACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003473.2-2351s21c1
Sequence:CCGGACAAAGTTGTTAGCGTATTTACTCGAGTAAATACGCTAACAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003473.x-485s1c1
Sequence:CCGGCTAGTGAAGTAAGCAACGTATCTCGAGATACGTTGCTTACTTCACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003473.x-794s1c1
Sequence:CCGGCCCTTTCCACTTTGTATCCAACTCGAGTTGGATACAAAGTGGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003473.x-430s1c1
Sequence:CCGGTGTGTATCAAACTGTGGCAAACTCGAGTTTGCCACAGTTTGATACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003473.x-1869s1c1
Sequence:CCGGCTGCTAAATGCCACTGACAATCTCGAGATTGTCAGTGGCATTTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003473.x-1734s1c1
Sequence:CCGGCCAGGTGCCAAACTATAACTTCTCGAGAAGTTATAGTTTGGCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003473
VALIDATED
STAM MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003473.2-1340s21c1
Sequence:GTACCGGTGAACGAAGATCCGATGTATTCTCGAGAATACATCGGATCTTCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-973s21c1
Sequence:CCGGCATCAAGGCATAGGGTTATTTCTCGAGAAATAACCCTATGCCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-488s21c1
Sequence:CCGGGTGAAGTAAGCAACGTATTAACTCGAGTTAATACGTTGCTTACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-347s21c1
Sequence:CCGGAGGATTGTCTTCGGTCTATTACTCGAGTAATAGACCGAAGACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003473.2-2351s21c1
Sequence:CCGGACAAAGTTGTTAGCGTATTTACTCGAGTAAATACGCTAACAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003473.x-485s1c1
Sequence:CCGGCTAGTGAAGTAAGCAACGTATCTCGAGATACGTTGCTTACTTCACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003473.x-794s1c1
Sequence:CCGGCCCTTTCCACTTTGTATCCAACTCGAGTTGGATACAAAGTGGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003473.x-430s1c1
Sequence:CCGGTGTGTATCAAACTGTGGCAAACTCGAGTTTGCCACAGTTTGATACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003473.x-1869s1c1
Sequence:CCGGCTGCTAAATGCCACTGACAATCTCGAGATTGTCAGTGGCATTTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003473.x-1734s1c1
Sequence:CCGGCCAGGTGCCAAACTATAACTTCTCGAGAAGTTATAGTTTGGCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003473
VALIDATED
STAM MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003473.2-1340s21c1
Sequence:GTACCGGTGAACGAAGATCCGATGTATTCTCGAGAATACATCGGATCTTCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-973s21c1
Sequence:CCGGCATCAAGGCATAGGGTTATTTCTCGAGAAATAACCCTATGCCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-488s21c1
Sequence:CCGGGTGAAGTAAGCAACGTATTAACTCGAGTTAATACGTTGCTTACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003473.2-347s21c1
Sequence:CCGGAGGATTGTCTTCGGTCTATTACTCGAGTAATAGACCGAAGACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003473.2-2351s21c1
Sequence:CCGGACAAAGTTGTTAGCGTATTTACTCGAGTAAATACGCTAACAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003473.x-485s1c1
Sequence:CCGGCTAGTGAAGTAAGCAACGTATCTCGAGATACGTTGCTTACTTCACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003473.x-794s1c1
Sequence:CCGGCCCTTTCCACTTTGTATCCAACTCGAGTTGGATACAAAGTGGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003473.x-430s1c1
Sequence:CCGGTGTGTATCAAACTGTGGCAAACTCGAGTTTGCCACAGTTTGATACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003473.x-1869s1c1
Sequence:CCGGCTGCTAAATGCCACTGACAATCTCGAGATTGTCAGTGGCATTTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003473.x-1734s1c1
Sequence:CCGGCCAGGTGCCAAACTATAACTTCTCGAGAAGTTATAGTTTGGCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks