EMAIL THIS PAGE TO A FRIEND

STAMBP

STAM binding protein

Synonyms: AMSH MICCAP
UniProtKB ID: O95630, D6W5H7, Q3MJE7
Gene ID:
Human(10617) Summary: Cytokine-mediated signal transduction in the JAK-STAT cascade requires the involvement of adaptor molecules. One such signal-transducing adaptor molecule contains an SH3 domain that is required for induction of MYC and cell growth. The protein encoded by this gene binds to the SH3 domain of the signal-transducing adaptor molecule, and plays a critical role in cytokine-mediated signaling for MYC induction and cell cycle progression. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70527) STAM binding protein
Rat(171565) Stam binding protein
cow(532672) STAM binding protein
sheep(101114002) STAM binding protein
domestic guinea pig(100716723) STAM binding protein
Domestic Rabbit(100351063) STAM binding protein
naked mole-rat(101711505) STAM binding protein
chicken(425176) STAM binding protein
domestic cat(101082485) STAM binding protein
dog(100684058) STAM binding protein
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006463 Rosetta Predictions human pricing
NM_201647 Rosetta Predictions human pricing
NM_213622 Rosetta Predictions human pricing
NM_138531 Rosetta Predictions rat pricing
NM_024239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182263 predicted 531
2 SASI_Hs01_00182264 predicted 1096
3 SASI_Hs01_00182265 predicted 527
4 SASI_Hs01_00182268 predicted 745
5 SASI_Hs01_00182269 predicted 1465
6 SASI_Hs01_00182262 predicted 384
7 SASI_Hs01_00182270 predicted 1105
8 SASI_Hs01_00182271 predicted 1286
9 SASI_Hs02_00341619 predicted 983
10 SASI_Hs02_00341620 predicted 985
11 SASI_Hs01_00182266 predicted 427
12 SASI_Hs01_00182267 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112344 predicted 384
2 SASI_Hs01_00112345 predicted 951
3 SASI_Hs01_00112346 predicted 392
4 SASI_Hs01_00112349 predicted 600
5 SASI_Hs01_00112350 predicted 1321
6 SASI_Hs01_00112343 predicted 245
7 SASI_Hs01_00112351 predicted 966
8 SASI_Hs01_00112352 predicted 1151
9 SASI_Hs02_00373149 predicted 841
10 SASI_Hs02_00373150 predicted 854
11 SASI_Hs01_00112347 predicted 289
12 SASI_Hs01_00112348 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051759 predicted 843
2 SASI_Hs01_00051760 predicted 1404
3 SASI_Hs01_00051761 predicted 839
4 SASI_Hs01_00051764 predicted 1057
5 SASI_Hs01_00051765 predicted 1779
6 SASI_Hs01_00051758 predicted 697
7 SASI_Hs01_00051766 predicted 1420
8 SASI_Hs01_00051767 predicted 1607
9 SASI_Hs02_00374307 predicted 1293
10 SASI_Hs02_00374308 predicted 1305
11 SASI_Hs01_00051762 predicted 743
12 SASI_Hs01_00051763 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065480 predicted 371
2 SASI_Rn01_00065481 predicted 939
3 SASI_Rn01_00065482 predicted 506
4 SASI_Rn01_00065484 predicted 340
5 SASI_Rn01_00065485 predicted 451
6 SASI_Rn02_00268162 predicted 1325
7 SASI_Rn01_00065487 predicted 1293
8 SASI_Rn01_00065488 predicted 1365
9 SASI_Rn02_00268163 predicted 1004
10 SASI_Rn02_00268164 predicted 622
11 SASI_Rn01_00065483 predicted 932
12 SASI_Rn01_00065486 predicted 1020
13 SASI_Rn01_00065489 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114703 predicted 281
2 SASI_Mm01_00114704 predicted 267
3 SASI_Mm01_00114705 predicted 754
4 SASI_Mm01_00114706 predicted 967
5 SASI_Mm01_00114707 predicted 406
6 SASI_Mm01_00114708 predicted 294
7 SASI_Mm02_00327609 predicted 451
8 SASI_Mm01_00114709 predicted 280
9 SASI_Mm01_00114710 predicted 1286
10 SASI_Mm01_00114712 predicted 279
11 SASI_Mm01_00114711 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024239
VALIDATED
STAMBP MISSION shRNA Bacterial Glycerol Stock
STAM binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024239.1-1830s21c1
Sequence:CCGGGCCTTCTGTTCCTCTTGAAATCTCGAGATTTCAAGAGGAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-282s21c1
Sequence:CCGGCCGAGACTACAAATCAGCTATCTCGAGATAGCTGATTTGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-831s21c1
Sequence:CCGGCCGTAATCTGTGCTCAGAATTCTCGAGAATTCTGAGCACAGATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-212s21c1
Sequence:CCGGGCAACATTGAACATGCCTTTACTCGAGTAAAGGCATGTTCAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-395s21c1
Sequence:CCGGCCAAAGAATATGAGCAGTATACTCGAGTATACTGCTCATATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024239.1-1830s1c1
Sequence:CCGGGCCTTCTGTTCCTCTTGAAATCTCGAGATTTCAAGAGGAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-282s1c1
Sequence:CCGGCCGAGACTACAAATCAGCTATCTCGAGATAGCTGATTTGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-212s1c1
Sequence:CCGGGCAACATTGAACATGCCTTTACTCGAGTAAAGGCATGTTCAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-395s1c1
Sequence:CCGGCCAAAGAATATGAGCAGTATACTCGAGTATACTGCTCATATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024239.1-831s1c1
Sequence:CCGGCCGTAATCTGTGCTCAGAATTCTCGAGAATTCTGAGCACAGATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024239
VALIDATED
STAMBP MISSION shRNA shRNA Plasmid DNA
STAM binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024239.1-1830s21c1
Sequence:CCGGGCCTTCTGTTCCTCTTGAAATCTCGAGATTTCAAGAGGAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-282s21c1
Sequence:CCGGCCGAGACTACAAATCAGCTATCTCGAGATAGCTGATTTGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-831s21c1
Sequence:CCGGCCGTAATCTGTGCTCAGAATTCTCGAGAATTCTGAGCACAGATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-212s21c1
Sequence:CCGGGCAACATTGAACATGCCTTTACTCGAGTAAAGGCATGTTCAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-395s21c1
Sequence:CCGGCCAAAGAATATGAGCAGTATACTCGAGTATACTGCTCATATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024239.1-1830s1c1
Sequence:CCGGGCCTTCTGTTCCTCTTGAAATCTCGAGATTTCAAGAGGAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-282s1c1
Sequence:CCGGCCGAGACTACAAATCAGCTATCTCGAGATAGCTGATTTGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-212s1c1
Sequence:CCGGGCAACATTGAACATGCCTTTACTCGAGTAAAGGCATGTTCAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-395s1c1
Sequence:CCGGCCAAAGAATATGAGCAGTATACTCGAGTATACTGCTCATATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024239.1-831s1c1
Sequence:CCGGCCGTAATCTGTGCTCAGAATTCTCGAGAATTCTGAGCACAGATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024239
VALIDATED
STAMBP MISSION shRNA Lentiviral Transduction Particles
STAM binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024239.1-1830s21c1
Sequence:CCGGGCCTTCTGTTCCTCTTGAAATCTCGAGATTTCAAGAGGAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-282s21c1
Sequence:CCGGCCGAGACTACAAATCAGCTATCTCGAGATAGCTGATTTGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-831s21c1
Sequence:CCGGCCGTAATCTGTGCTCAGAATTCTCGAGAATTCTGAGCACAGATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-212s21c1
Sequence:CCGGGCAACATTGAACATGCCTTTACTCGAGTAAAGGCATGTTCAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024239.1-395s21c1
Sequence:CCGGCCAAAGAATATGAGCAGTATACTCGAGTATACTGCTCATATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024239.1-1830s1c1
Sequence:CCGGGCCTTCTGTTCCTCTTGAAATCTCGAGATTTCAAGAGGAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-282s1c1
Sequence:CCGGCCGAGACTACAAATCAGCTATCTCGAGATAGCTGATTTGTAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-212s1c1
Sequence:CCGGGCAACATTGAACATGCCTTTACTCGAGTAAAGGCATGTTCAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024239.1-395s1c1
Sequence:CCGGCCAAAGAATATGAGCAGTATACTCGAGTATACTGCTCATATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024239.1-831s1c1
Sequence:CCGGCCGTAATCTGTGCTCAGAATTCTCGAGAATTCTGAGCACAGATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006463
VALIDATED
STAMBP MISSION shRNA Bacterial Glycerol Stock
STAM binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-1301s21c1
Sequence:CCGGTCCAGGAAACTGGATTCTTTACTCGAGTAAAGAATCCAGTTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006463.3-1929s21c1
Sequence:CCGGGCAATATGAATGGAGCTTATTCTCGAGAATAAGCTCCATTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-855s21c1
Sequence:CCGGCACAACTGTAAGGCCAGCTAACTCGAGTTAGCTGGCCTTACAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-1267s21c1
Sequence:CCGGCCAGAGTCAGTAGCCATTGTTCTCGAGAACAATGGCTACTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1929s1c1
Sequence:CCGGGCAATATGAATGGAGCTTATTCTCGAGAATAAGCTCCATTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1301s1c1
Sequence:CCGGTCCAGGAAACTGGATTCTTTACTCGAGTAAAGAATCCAGTTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-855s1c1
Sequence:CCGGCACAACTGTAAGGCCAGCTAACTCGAGTTAGCTGGCCTTACAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006463.3-328s1c1
Sequence:CCGGGCATCCATTTACTCTGAGGAACTCGAGTTCCTCAGAGTAAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1267s1c1
Sequence:CCGGCCAGAGTCAGTAGCCATTGTTCTCGAGAACAATGGCTACTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006463
VALIDATED
STAMBP MISSION shRNA shRNA Plasmid DNA
STAM binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-1301s21c1
Sequence:CCGGTCCAGGAAACTGGATTCTTTACTCGAGTAAAGAATCCAGTTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006463.3-1929s21c1
Sequence:CCGGGCAATATGAATGGAGCTTATTCTCGAGAATAAGCTCCATTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-855s21c1
Sequence:CCGGCACAACTGTAAGGCCAGCTAACTCGAGTTAGCTGGCCTTACAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-1267s21c1
Sequence:CCGGCCAGAGTCAGTAGCCATTGTTCTCGAGAACAATGGCTACTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1929s1c1
Sequence:CCGGGCAATATGAATGGAGCTTATTCTCGAGAATAAGCTCCATTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1301s1c1
Sequence:CCGGTCCAGGAAACTGGATTCTTTACTCGAGTAAAGAATCCAGTTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-855s1c1
Sequence:CCGGCACAACTGTAAGGCCAGCTAACTCGAGTTAGCTGGCCTTACAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006463.3-328s1c1
Sequence:CCGGGCATCCATTTACTCTGAGGAACTCGAGTTCCTCAGAGTAAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1267s1c1
Sequence:CCGGCCAGAGTCAGTAGCCATTGTTCTCGAGAACAATGGCTACTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006463
VALIDATED
STAMBP MISSION shRNA Lentiviral Transduction Particles
STAM binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-1301s21c1
Sequence:CCGGTCCAGGAAACTGGATTCTTTACTCGAGTAAAGAATCCAGTTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006463.3-1929s21c1
Sequence:CCGGGCAATATGAATGGAGCTTATTCTCGAGAATAAGCTCCATTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-855s21c1
Sequence:CCGGCACAACTGTAAGGCCAGCTAACTCGAGTTAGCTGGCCTTACAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006463.3-1267s21c1
Sequence:CCGGCCAGAGTCAGTAGCCATTGTTCTCGAGAACAATGGCTACTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1929s1c1
Sequence:CCGGGCAATATGAATGGAGCTTATTCTCGAGAATAAGCTCCATTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1301s1c1
Sequence:CCGGTCCAGGAAACTGGATTCTTTACTCGAGTAAAGAATCCAGTTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-855s1c1
Sequence:CCGGCACAACTGTAAGGCCAGCTAACTCGAGTTAGCTGGCCTTACAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006463.3-328s1c1
Sequence:CCGGGCATCCATTTACTCTGAGGAACTCGAGTTCCTCAGAGTAAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006463.3-1267s1c1
Sequence:CCGGCCAGAGTCAGTAGCCATTGTTCTCGAGAACAATGGCTACTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks