EMAIL THIS PAGE TO A FRIEND

STAMBPL1

STAM binding protein-like 1

Synonyms: ALMalpha AMSH-FP AMSH-LP bA399O19.2
UniProtKB ID: Q96FJ0, B3KPA7, Q5T9N4, Q5T9N9, Q7Z420, Q9P2H4
Gene ID:
Mouse(76630) STAM binding protein like 1
Rat(687696) STAM binding protein-like 1
chicken(100859108) STAM binding protein-like 1
dog(477586) STAM binding protein-like 1
domestic cat(101093298) STAM binding protein-like 1
Horse(100062209) STAM binding protein-like 1
naked mole-rat(101717372) STAM binding protein-like 1
domestic guinea pig(100720263) STAM binding protein-like 1
cow(538785) STAM binding protein-like 1
sheep(101120789) STAM binding protein-like 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020799 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020799 Rosetta Predictions human pricing
NM_001115048 Rosetta Predictions rat pricing
NM_029682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241436 predicted 982
2 SASI_Hs01_00241437 predicted 1074
3 SASI_Hs01_00241438 predicted 516
4 SASI_Hs01_00241439 predicted 1148
5 SASI_Hs01_00241440 predicted 1285
6 SASI_Hs01_00241441 predicted 1380
7 SASI_Hs01_00241442 predicted 739
8 SASI_Hs01_00241443 predicted 991
9 SASI_Hs01_00241444 predicted 1195
10 SASI_Hs01_00241445 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252653 predicted 394
2 SASI_Rn02_00252654 predicted 379
3 SASI_Rn02_00252655 predicted 460
4 SASI_Rn02_00252656 predicted 1074
5 SASI_Rn02_00252657 predicted 1098
6 SASI_Rn02_00252658 predicted 341
7 SASI_Rn02_00252659 predicted 808
8 SASI_Rn02_00252660 predicted 301
9 SASI_Rn02_00252661 predicted 1247
10 SASI_Rn02_00252662 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031467 predicted 709
2 SASI_Mm01_00031468 predicted 1327
3 SASI_Mm01_00031469 predicted 1336
4 SASI_Mm01_00031470 predicted 517
5 SASI_Mm01_00031471 predicted 1194
6 SASI_Mm01_00031472 predicted 517
7 SASI_Mm01_00031473 predicted 1224
8 SASI_Mm01_00031474 predicted 1079
9 SASI_Mm01_00031475 predicted 501
10 SASI_Mm02_00335718 predicted 1261
11 SASI_Mm01_00031476 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029682
VALIDATED
STAMBPL1 MISSION shRNA Bacterial Glycerol Stock
STAM binding protein-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029682.2-1490s1c1
Sequence:CCGGGCCGAATTTCTTACGATGTTTCTCGAGAAACATCGTAAGAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029682.2-300s1c1
Sequence:CCGGCGGAGTGGAAATGGAAAGGATCTCGAGATCCTTTCCATTTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029682.2-234s1c1
Sequence:CCGGCCTAAGCAAACTTGGTTGTAACTCGAGTTACAACCAAGTTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029682.2-1326s1c1
Sequence:CCGGGCTTGAGGTTTCTACTTGTAACTCGAGTTACAAGTAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029682.2-506s1c1
Sequence:CCGGCGGACCTGCTAAGGAAATATACTCGAGTATATTTCCTTAGCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-1600s21c1
Sequence:CCGGGCTTGAGGTTTCTACTTGTAACTCGAGTTACAAGTAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-780s21c1
Sequence:CCGGCGGACCTGCTAAGGAAATATACTCGAGTATATTTCCTTAGCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-574s21c1
Sequence:CCGGCGGAGTGGAAATGGAAAGGATCTCGAGATCCTTTCCATTTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-1783s21c1
Sequence:CCGGTTTCAGAAGTGACTGATATTTCTCGAGAAATATCAGTCACTTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029682
VALIDATED
STAMBPL1 MISSION shRNA shRNA Plasmid DNA
STAM binding protein-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029682.2-1490s1c1
Sequence:CCGGGCCGAATTTCTTACGATGTTTCTCGAGAAACATCGTAAGAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029682.2-300s1c1
Sequence:CCGGCGGAGTGGAAATGGAAAGGATCTCGAGATCCTTTCCATTTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029682.2-234s1c1
Sequence:CCGGCCTAAGCAAACTTGGTTGTAACTCGAGTTACAACCAAGTTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029682.2-1326s1c1
Sequence:CCGGGCTTGAGGTTTCTACTTGTAACTCGAGTTACAAGTAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029682.2-506s1c1
Sequence:CCGGCGGACCTGCTAAGGAAATATACTCGAGTATATTTCCTTAGCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-1600s21c1
Sequence:CCGGGCTTGAGGTTTCTACTTGTAACTCGAGTTACAAGTAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-780s21c1
Sequence:CCGGCGGACCTGCTAAGGAAATATACTCGAGTATATTTCCTTAGCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-574s21c1
Sequence:CCGGCGGAGTGGAAATGGAAAGGATCTCGAGATCCTTTCCATTTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-1783s21c1
Sequence:CCGGTTTCAGAAGTGACTGATATTTCTCGAGAAATATCAGTCACTTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029682
VALIDATED
STAMBPL1 MISSION shRNA Lentiviral Transduction Particles
STAM binding protein-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029682.2-1490s1c1
Sequence:CCGGGCCGAATTTCTTACGATGTTTCTCGAGAAACATCGTAAGAAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029682.2-300s1c1
Sequence:CCGGCGGAGTGGAAATGGAAAGGATCTCGAGATCCTTTCCATTTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029682.2-234s1c1
Sequence:CCGGCCTAAGCAAACTTGGTTGTAACTCGAGTTACAACCAAGTTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029682.2-1326s1c1
Sequence:CCGGGCTTGAGGTTTCTACTTGTAACTCGAGTTACAAGTAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029682.2-506s1c1
Sequence:CCGGCGGACCTGCTAAGGAAATATACTCGAGTATATTTCCTTAGCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-1600s21c1
Sequence:CCGGGCTTGAGGTTTCTACTTGTAACTCGAGTTACAAGTAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-780s21c1
Sequence:CCGGCGGACCTGCTAAGGAAATATACTCGAGTATATTTCCTTAGCAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-574s21c1
Sequence:CCGGCGGAGTGGAAATGGAAAGGATCTCGAGATCCTTTCCATTTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029682.4-1783s21c1
Sequence:CCGGTTTCAGAAGTGACTGATATTTCTCGAGAAATATCAGTCACTTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020799
VALIDATED
STAMBPL1 MISSION shRNA Bacterial Glycerol Stock
STAM binding protein-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-787s1c1
Sequence:CCGGGCTGCTACTCTAAGTGCTGTTCTCGAGAACAGCACTTAGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-1221s1c1
Sequence:CCGGGCTTGAGGTTTCTGCTTGTAACTCGAGTTACAAGCAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-684s1c1
Sequence:CCGGCCAGAACAATTCCTTGCTGAACTCGAGTTCAGCAAGGAATTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-76s1c1
Sequence:CCGGGCTATGCCTGACCATACAGATCTCGAGATCTGTATGGTCAGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-297s1c1
Sequence:CCGGGCTTCCTAACCATCGAGATTACTCGAGTAATCTCGATGGTTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-560s21c1
Sequence:CCGGTCACTCCACGACGTTACTTTACTCGAGTAAAGTAACGTCGTGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1779s21c1
Sequence:CCGGGGACATGTGGTTGCCGGATTTCTCGAGAAATCCGGCAACCACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-1718s21c1
Sequence:CCGGTGTTGGATCTGAGGTGATATGCTCGAGCATATCACCTCAGATCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-984s21c1
Sequence:CCGGAGAGTTAGCCCGAGGTCAAATCTCGAGATTTGACCTCGGGCTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1742s21c1
Sequence:CCGGTGAATGTAAGCACCGTCAACACTCGAGTGTTGACGGTGCTTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-812s21c1
Sequence:CCGGACGTAGAATACCAAGAATATTCTCGAGAATATTCTTGGTATTCTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1806s21c1
Sequence:CCGGGATGTTTCCAGAAATGACTGACTCGAGTCAGTCATTTCTGGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020799
VALIDATED
STAMBPL1 MISSION shRNA shRNA Plasmid DNA
STAM binding protein-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-787s1c1
Sequence:CCGGGCTGCTACTCTAAGTGCTGTTCTCGAGAACAGCACTTAGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-1221s1c1
Sequence:CCGGGCTTGAGGTTTCTGCTTGTAACTCGAGTTACAAGCAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-684s1c1
Sequence:CCGGCCAGAACAATTCCTTGCTGAACTCGAGTTCAGCAAGGAATTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-76s1c1
Sequence:CCGGGCTATGCCTGACCATACAGATCTCGAGATCTGTATGGTCAGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-297s1c1
Sequence:CCGGGCTTCCTAACCATCGAGATTACTCGAGTAATCTCGATGGTTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-560s21c1
Sequence:CCGGTCACTCCACGACGTTACTTTACTCGAGTAAAGTAACGTCGTGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1779s21c1
Sequence:CCGGGGACATGTGGTTGCCGGATTTCTCGAGAAATCCGGCAACCACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-1718s21c1
Sequence:CCGGTGTTGGATCTGAGGTGATATGCTCGAGCATATCACCTCAGATCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-984s21c1
Sequence:CCGGAGAGTTAGCCCGAGGTCAAATCTCGAGATTTGACCTCGGGCTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1742s21c1
Sequence:CCGGTGAATGTAAGCACCGTCAACACTCGAGTGTTGACGGTGCTTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-812s21c1
Sequence:CCGGACGTAGAATACCAAGAATATTCTCGAGAATATTCTTGGTATTCTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1806s21c1
Sequence:CCGGGATGTTTCCAGAAATGACTGACTCGAGTCAGTCATTTCTGGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020799
VALIDATED
STAMBPL1 MISSION shRNA Lentiviral Transduction Particles
STAM binding protein-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-787s1c1
Sequence:CCGGGCTGCTACTCTAAGTGCTGTTCTCGAGAACAGCACTTAGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-1221s1c1
Sequence:CCGGGCTTGAGGTTTCTGCTTGTAACTCGAGTTACAAGCAGAAACCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-684s1c1
Sequence:CCGGCCAGAACAATTCCTTGCTGAACTCGAGTTCAGCAAGGAATTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-76s1c1
Sequence:CCGGGCTATGCCTGACCATACAGATCTCGAGATCTGTATGGTCAGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020799.1-297s1c1
Sequence:CCGGGCTTCCTAACCATCGAGATTACTCGAGTAATCTCGATGGTTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-560s21c1
Sequence:CCGGTCACTCCACGACGTTACTTTACTCGAGTAAAGTAACGTCGTGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1779s21c1
Sequence:CCGGGGACATGTGGTTGCCGGATTTCTCGAGAAATCCGGCAACCACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-1718s21c1
Sequence:CCGGTGTTGGATCTGAGGTGATATGCTCGAGCATATCACCTCAGATCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-984s21c1
Sequence:CCGGAGAGTTAGCCCGAGGTCAAATCTCGAGATTTGACCTCGGGCTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1742s21c1
Sequence:CCGGTGAATGTAAGCACCGTCAACACTCGAGTGTTGACGGTGCTTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020799.2-812s21c1
Sequence:CCGGACGTAGAATACCAAGAATATTCTCGAGAATATTCTTGGTATTCTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020799.2-1806s21c1
Sequence:CCGGGATGTTTCCAGAAATGACTGACTCGAGTCAGTCATTTCTGGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks