EMAIL THIS PAGE TO A FRIEND

STAP1

signal transducing adaptor family member 1

Synonyms: BRDG1 STAP-1
UniProtKB ID: Q9ULZ2, B2R980
Gene ID:
Human(26228) Summary: The protein encoded by this gene functions as a docking protein acting downstream of Tec tyrosine kinase in B cell antigen receptor signaling. The protein is directly phosphorylated by Tec in vitro where it participates in a postive feedback loop, increasing Tec activity. [provided by RefSeq, Jul 2008]
Mouse(56792) signal transducing adaptor family member 1
Rat(305269) signal transducing adaptor family member 1
chicken(428761) signal transducing adaptor family member 1
dog(482171) signal transducing adaptor family member 1
domestic cat(101100559) signal transducing adaptor family member 1
cow(507296) signal transducing adaptor family member 1
sheep(101115032) signal transducing adaptor family member 1
domestic guinea pig(100722510) signal transducing adaptor family member 1
naked mole-rat(101712972) signal transducing adaptor family member 1
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018201 MISSION® esiRNA esiRNA targeting human BRDG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012108 Rosetta Predictions human pricing
NM_001025115 Rosetta Predictions rat pricing
NM_019992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343633 predicted 803
2 SASI_Hs01_00134031 predicted 732
3 SASI_Hs01_00134032 predicted 972
4 SASI_Hs01_00134033 predicted 901
5 SASI_Hs02_00343634 predicted 635
6 SASI_Hs01_00134035 predicted 334
7 SASI_Hs01_00134036 predicted 197
8 SASI_Hs01_00134037 predicted 476
9 SASI_Hs02_00343635 predicted 528
10 SASI_Hs01_00134038 predicted 754
11 SASI_Hs01_00134030 predicted 1045
12 SASI_Hs01_00134034 predicted 988
13 SASI_Hs01_00134039 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045860 predicted 940
2 SASI_Rn01_00045861 predicted 936
3 SASI_Rn01_00045862 predicted 813
4 SASI_Rn01_00045863 predicted 762
5 SASI_Rn01_00045864 predicted 216
6 SASI_Rn01_00045865 predicted 417
7 SASI_Rn01_00045866 predicted 816
8 SASI_Rn01_00045867 predicted 999
9 SASI_Rn01_00045868 predicted 221
10 SASI_Rn01_00045869 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045445 predicted 841
2 SASI_Mm01_00045446 predicted 461
3 SASI_Mm01_00045447 predicted 794
4 SASI_Mm01_00045448 predicted 825
5 SASI_Mm01_00045449 predicted 392
6 SASI_Mm01_00045450 predicted 463
7 SASI_Mm01_00045451 predicted 673
8 SASI_Mm01_00045452 predicted 444
9 SASI_Mm01_00045453 predicted 651
10 SASI_Mm01_00045454 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012108
STAP1 MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor family member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012108.2-661s21c1
Sequence:CCGGGAACCCTTCTTTGGGAAATATCTCGAGATATTTCCCAAAGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012108.2-1052s21c1
Sequence:CCGGATATTCTCCTGATACTGATTACTCGAGTAATCAGTATCAGGAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-747s1c1
Sequence:CCGGCCAAGAATCAAGCACTACAAACTCGAGTTTGTAGTGCTTGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-573s1c1
Sequence:CCGGCCAACTGAAGATTATGTGGATCTCGAGATCCACATAATCTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-810s1c1
Sequence:CCGGCCTGTAACACTCCCAAACCTTCTCGAGAAGGTTTGGGAGTGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-692s1c1
Sequence:CCGGGCCTGGTAGTGACAGTAGAAACTCGAGTTTCTACTGTCACTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-150s1c1
Sequence:CCGGGCTCTACCTTTGTACTTTGAACTCGAGTTCAAAGTACAAAGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012108
STAP1 MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor family member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012108.2-661s21c1
Sequence:CCGGGAACCCTTCTTTGGGAAATATCTCGAGATATTTCCCAAAGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012108.2-1052s21c1
Sequence:CCGGATATTCTCCTGATACTGATTACTCGAGTAATCAGTATCAGGAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-747s1c1
Sequence:CCGGCCAAGAATCAAGCACTACAAACTCGAGTTTGTAGTGCTTGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-573s1c1
Sequence:CCGGCCAACTGAAGATTATGTGGATCTCGAGATCCACATAATCTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-810s1c1
Sequence:CCGGCCTGTAACACTCCCAAACCTTCTCGAGAAGGTTTGGGAGTGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-692s1c1
Sequence:CCGGGCCTGGTAGTGACAGTAGAAACTCGAGTTTCTACTGTCACTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-150s1c1
Sequence:CCGGGCTCTACCTTTGTACTTTGAACTCGAGTTCAAAGTACAAAGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012108
STAP1 MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor family member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012108.2-661s21c1
Sequence:CCGGGAACCCTTCTTTGGGAAATATCTCGAGATATTTCCCAAAGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012108.2-1052s21c1
Sequence:CCGGATATTCTCCTGATACTGATTACTCGAGTAATCAGTATCAGGAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-747s1c1
Sequence:CCGGCCAAGAATCAAGCACTACAAACTCGAGTTTGTAGTGCTTGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-573s1c1
Sequence:CCGGCCAACTGAAGATTATGTGGATCTCGAGATCCACATAATCTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-810s1c1
Sequence:CCGGCCTGTAACACTCCCAAACCTTCTCGAGAAGGTTTGGGAGTGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-692s1c1
Sequence:CCGGGCCTGGTAGTGACAGTAGAAACTCGAGTTTCTACTGTCACTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012108.1-150s1c1
Sequence:CCGGGCTCTACCTTTGTACTTTGAACTCGAGTTCAAAGTACAAAGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019992
STAP1 MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-828s1c1
Sequence:CCGGGCTGATGACAACTTTGGTCAACTCGAGTTGACCAAAGTTGTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019992.2-911s1c1
Sequence:CCGGCATGACACCTTTCTTCATTTACTCGAGTAAATGAAGAAAGGTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-198s1c1
Sequence:CCGGACAATCTATGTTGGCAAGTTACTCGAGTAACTTGCCAACATAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-126s1c1
Sequence:CCGGCACCAGGAGTACAAACACTATCTCGAGATAGTGTTTGTACTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-798s1c1
Sequence:CCGGCGAGGGAATTTGAGACCATTTCTCGAGAAATGGTCTCAAATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019992
STAP1 MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-828s1c1
Sequence:CCGGGCTGATGACAACTTTGGTCAACTCGAGTTGACCAAAGTTGTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019992.2-911s1c1
Sequence:CCGGCATGACACCTTTCTTCATTTACTCGAGTAAATGAAGAAAGGTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-198s1c1
Sequence:CCGGACAATCTATGTTGGCAAGTTACTCGAGTAACTTGCCAACATAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-126s1c1
Sequence:CCGGCACCAGGAGTACAAACACTATCTCGAGATAGTGTTTGTACTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-798s1c1
Sequence:CCGGCGAGGGAATTTGAGACCATTTCTCGAGAAATGGTCTCAAATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019992
STAP1 MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-828s1c1
Sequence:CCGGGCTGATGACAACTTTGGTCAACTCGAGTTGACCAAAGTTGTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019992.2-911s1c1
Sequence:CCGGCATGACACCTTTCTTCATTTACTCGAGTAAATGAAGAAAGGTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-198s1c1
Sequence:CCGGACAATCTATGTTGGCAAGTTACTCGAGTAACTTGCCAACATAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-126s1c1
Sequence:CCGGCACCAGGAGTACAAACACTATCTCGAGATAGTGTTTGTACTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019992.2-798s1c1
Sequence:CCGGCGAGGGAATTTGAGACCATTTCTCGAGAAATGGTCTCAAATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks