EMAIL THIS PAGE TO A FRIEND

STAP2

signal transducing adaptor family member 2

Synonyms: BKS
UniProtKB ID: Q9UGK3, A6NKK3, Q9NXI2
Gene ID:
Human(55620) Summary: This gene encodes the substrate of breast tumor kinase, an Src-type non-receptor tyrosine kinase. The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(106766) signal transducing adaptor family member 2
Rat(363334) signal transducing adaptor family member 2
naked mole-rat(101703465) signal transducing adaptor family member 2
domestic guinea pig(100732424) signal transducing adaptor family member 2
cow(505456) signal transducing adaptor family member 2
sheep(101112312) signal transducing adaptor family member 2
domestic cat(101080361) signal transducing adaptor family member 2
dog(485041) signal transducing adaptor family member 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017720 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013841 Rosetta Predictions human pricing
NM_017720 Rosetta Predictions human pricing
NM_001025026 Rosetta Predictions rat pricing
NM_145934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042422 predicted 863
2 SASI_Hs02_00306498 predicted 727
3 SASI_Hs01_00042424 predicted 401
4 SASI_Hs01_00042425 predicted 394
5 SASI_Hs01_00042426 predicted 258
6 SASI_Hs01_00042428 predicted 388
7 SASI_Hs01_00042429 predicted 289
8 SASI_Hs01_00042430 predicted 350
9 SASI_Hs01_00042431 predicted 780
10 SASI_Hs02_00306499 predicted 488
11 SASI_Hs01_00042423 predicted 228
12 SASI_Hs01_00042427 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110310 predicted 865
2 SASI_Hs02_00350491 predicted 728
3 SASI_Hs01_00110312 predicted 401
4 SASI_Hs01_00110313 predicted 397
5 SASI_Hs01_00110314 predicted 253
6 SASI_Hs01_00110316 predicted 388
7 SASI_Hs01_00110317 predicted 288
8 SASI_Hs01_00110318 predicted 342
9 SASI_Hs01_00110319 predicted 781
10 SASI_Hs02_00350492 predicted 481
11 SASI_Hs01_00110311 predicted 229
12 SASI_Hs01_00110315 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050076 predicted 1053
2 SASI_Rn02_00202939 predicted 915
3 SASI_Rn01_00050077 predicted 720
4 SASI_Rn01_00050078 predicted 276
5 SASI_Rn01_00050079 predicted 1099
6 SASI_Rn01_00050080 predicted 939
7 SASI_Rn01_00050081 predicted 1074
8 SASI_Rn01_00050082 predicted 1022
9 SASI_Rn01_00050083 predicted 798
10 SASI_Rn02_00202940 predicted 261
11 SASI_Rn01_00050084 predicted 723
12 SASI_Rn01_00050085 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067923 predicted 1047
2 SASI_Mm01_00067924 predicted 1029
3 SASI_Mm01_00067925 predicted 1157
4 SASI_Mm01_00067926 predicted 658
5 SASI_Mm01_00067927 predicted 288
6 SASI_Mm01_00067928 predicted 1029
7 SASI_Mm01_00067929 predicted 718
8 SASI_Mm01_00067930 predicted 995
9 SASI_Mm01_00067931 predicted 997
10 SASI_Mm02_00341388 predicted 361
11 SASI_Mm01_00067932 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145934
VALIDATED
STAP2 MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-178s1c1
Sequence:CCGGCCAGGGTTTAGCCATCTGTTTCTCGAGAAACAGATGGCTAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-644s1c1
Sequence:CCGGCCCGTGGTCAAACACTACAAACTCGAGTTTGTAGTGTTTGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-1424s1c1
Sequence:CCGGCCCTGAGCTGTATAGTGAGTTCTCGAGAACTCACTATACAGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145934.1-944s1c1
Sequence:CCGGGAAGACAAGTTGCCTCAACTACTCGAGTAGTTGAGGCAACTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145934.1-1031s1c1
Sequence:CCGGGCCGAATACATGAATCAGGATCTCGAGATCCTGATTCATGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145934.1-1307s21c1
Sequence:CCGGGGGCTATCTCTGGGTACAATACTCGAGTATTGTACCCAGAGATAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145934.1-1134s21c1
Sequence:CCGGTGCCTAAGCCAGATCTCAAAGCTCGAGCTTTGAGATCTGGCTTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145934.1-669s21c1
Sequence:CCGGAGCGGGCAGGTTCTAAGTATGCTCGAGCATACTTAGAACCTGCCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145934
VALIDATED
STAP2 MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-178s1c1
Sequence:CCGGCCAGGGTTTAGCCATCTGTTTCTCGAGAAACAGATGGCTAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-644s1c1
Sequence:CCGGCCCGTGGTCAAACACTACAAACTCGAGTTTGTAGTGTTTGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-1424s1c1
Sequence:CCGGCCCTGAGCTGTATAGTGAGTTCTCGAGAACTCACTATACAGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145934.1-944s1c1
Sequence:CCGGGAAGACAAGTTGCCTCAACTACTCGAGTAGTTGAGGCAACTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145934.1-1031s1c1
Sequence:CCGGGCCGAATACATGAATCAGGATCTCGAGATCCTGATTCATGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145934.1-1307s21c1
Sequence:CCGGGGGCTATCTCTGGGTACAATACTCGAGTATTGTACCCAGAGATAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145934.1-1134s21c1
Sequence:CCGGTGCCTAAGCCAGATCTCAAAGCTCGAGCTTTGAGATCTGGCTTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145934.1-669s21c1
Sequence:CCGGAGCGGGCAGGTTCTAAGTATGCTCGAGCATACTTAGAACCTGCCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145934
VALIDATED
STAP2 MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-178s1c1
Sequence:CCGGCCAGGGTTTAGCCATCTGTTTCTCGAGAAACAGATGGCTAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-644s1c1
Sequence:CCGGCCCGTGGTCAAACACTACAAACTCGAGTTTGTAGTGTTTGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145934.1-1424s1c1
Sequence:CCGGCCCTGAGCTGTATAGTGAGTTCTCGAGAACTCACTATACAGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145934.1-944s1c1
Sequence:CCGGGAAGACAAGTTGCCTCAACTACTCGAGTAGTTGAGGCAACTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145934.1-1031s1c1
Sequence:CCGGGCCGAATACATGAATCAGGATCTCGAGATCCTGATTCATGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145934.1-1307s21c1
Sequence:CCGGGGGCTATCTCTGGGTACAATACTCGAGTATTGTACCCAGAGATAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145934.1-1134s21c1
Sequence:CCGGTGCCTAAGCCAGATCTCAAAGCTCGAGCTTTGAGATCTGGCTTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145934.1-669s21c1
Sequence:CCGGAGCGGGCAGGTTCTAAGTATGCTCGAGCATACTTAGAACCTGCCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017720
STAP2 MISSION shRNA Bacterial Glycerol Stock
signal transducing adaptor family member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-1080s1c1
Sequence:CCGGCCAAAGAAGTTGCCAAAGCCTCTCGAGAGGCTTTGGCAACTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-1283s1c1
Sequence:CCGGCAAAGTCTTTAATGGTGGCTTCTCGAGAAGCCACCATTAAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-267s1c1
Sequence:CCGGGCATTTGAGAAACTCACAGATCTCGAGATCTGTGAGTTTCTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-218s1c1
Sequence:CCGGCTACAATAGCAATCGGGACTTCTCGAGAAGTCCCGATTGCTATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-1023s1c1
Sequence:CCGGGCTGTTGACTATGAGAACCAACTCGAGTTGGTTCTCATAGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-1070s1c1
Sequence:CCGGCATCCTGAAGCCAAAGAAGTTCTCGAGAACTTCTTTGGCTTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-197s1c1
Sequence:CCGGGCAGGGTCTCACCATTTATTTCTCGAGAAATAAATGGTGAGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-761s1c1
Sequence:CCGGCTATTTCGTGTCGCATACCAACTCGAGTTGGTATGCGACACGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-845s1c1
Sequence:CCGGCGATAAGGAGAATGGCGAGAACTCGAGTTCTCGCCATTCTCCTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017720
STAP2 MISSION shRNA shRNA Plasmid DNA
signal transducing adaptor family member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-1080s1c1
Sequence:CCGGCCAAAGAAGTTGCCAAAGCCTCTCGAGAGGCTTTGGCAACTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-1283s1c1
Sequence:CCGGCAAAGTCTTTAATGGTGGCTTCTCGAGAAGCCACCATTAAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-267s1c1
Sequence:CCGGGCATTTGAGAAACTCACAGATCTCGAGATCTGTGAGTTTCTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-218s1c1
Sequence:CCGGCTACAATAGCAATCGGGACTTCTCGAGAAGTCCCGATTGCTATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-1023s1c1
Sequence:CCGGGCTGTTGACTATGAGAACCAACTCGAGTTGGTTCTCATAGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-1070s1c1
Sequence:CCGGCATCCTGAAGCCAAAGAAGTTCTCGAGAACTTCTTTGGCTTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-197s1c1
Sequence:CCGGGCAGGGTCTCACCATTTATTTCTCGAGAAATAAATGGTGAGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-761s1c1
Sequence:CCGGCTATTTCGTGTCGCATACCAACTCGAGTTGGTATGCGACACGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-845s1c1
Sequence:CCGGCGATAAGGAGAATGGCGAGAACTCGAGTTCTCGCCATTCTCCTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017720
STAP2 MISSION shRNA Lentiviral Transduction Particles
signal transducing adaptor family member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-1080s1c1
Sequence:CCGGCCAAAGAAGTTGCCAAAGCCTCTCGAGAGGCTTTGGCAACTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-1283s1c1
Sequence:CCGGCAAAGTCTTTAATGGTGGCTTCTCGAGAAGCCACCATTAAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-267s1c1
Sequence:CCGGGCATTTGAGAAACTCACAGATCTCGAGATCTGTGAGTTTCTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-218s1c1
Sequence:CCGGCTACAATAGCAATCGGGACTTCTCGAGAAGTCCCGATTGCTATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-1023s1c1
Sequence:CCGGGCTGTTGACTATGAGAACCAACTCGAGTTGGTTCTCATAGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-1070s1c1
Sequence:CCGGCATCCTGAAGCCAAAGAAGTTCTCGAGAACTTCTTTGGCTTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017720.1-197s1c1
Sequence:CCGGGCAGGGTCTCACCATTTATTTCTCGAGAAATAAATGGTGAGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-761s1c1
Sequence:CCGGCTATTTCGTGTCGCATACCAACTCGAGTTGGTATGCGACACGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017720.1-845s1c1
Sequence:CCGGCGATAAGGAGAATGGCGAGAACTCGAGTTCTCGCCATTCTCCTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks