EMAIL THIS PAGE TO A FRIEND

STAR

steroidogenic acute regulatory protein

Synonyms: STARD1
UniProtKB ID: P49675, Q16396
Gene ID:
Human(6770) Summary: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]
Mouse(20845) steroidogenic acute regulatory protein
Rat(25557) steroidogenic acute regulatory protein
Zebrafish(63999) steroidogenic acute regulatory protein
chicken(395421) steroidogenic acute regulatory protein
Horse(100009707) steroidogenic acute regulatory protein
domestic cat(100616071) steroidogenic acute regulatory protein
dog(475588) steroidogenic acute regulatory protein
cow(281507) steroidogenic acute regulatory protein
sheep(443122) steroidogenic acute regulatory protein
domestic guinea pig(100732626) steroidogenic acute regulatory protein
naked mole-rat(101708935) steroidogenic acute regulatory protein
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000349 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000349 Rosetta Predictions human pricing
NM_001007243 Rosetta Predictions human pricing
NM_031558 Rosetta Predictions rat pricing
NM_011485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120302 predicted 1397
2 SASI_Hs01_00120303 predicted 1518
3 SASI_Hs01_00120304 predicted 1183
4 SASI_Hs01_00120305 predicted 1256
5 SASI_Hs01_00120307 predicted 1320
6 SASI_Hs01_00120308 predicted 1332
7 SASI_Hs01_00120309 predicted 1101
8 SASI_Hs01_00120310 predicted 1432
9 SASI_Hs01_00120311 predicted 1012
10 SASI_Hs02_00302384 predicted 1476
11 SASI_Hs01_00120306 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042832 predicted 1344
2 SASI_Hs01_00042833 predicted 1462
3 SASI_Hs01_00042834 predicted 1132
4 SASI_Hs01_00042835 predicted 1205
5 SASI_Hs01_00042837 predicted 1272
6 SASI_Hs01_00042838 predicted 1283
7 SASI_Hs01_00042839 predicted 1047
8 SASI_Hs01_00042840 predicted 1374
9 SASI_Hs01_00042841 predicted 957
10 SASI_Hs02_00305262 predicted 1418
11 SASI_Hs01_00042836 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264768 predicted 320
2 SASI_Rn02_00264769 predicted 861
3 SASI_Rn02_00264770 predicted 813
4 SASI_Rn01_00089093 predicted 421
5 SASI_Rn02_00264771 predicted 552
6 SASI_Rn02_00264772 predicted 494
7 SASI_Rn02_00264773 predicted 699
8 SASI_Rn01_00089094 predicted 868
9 SASI_Rn02_00264774 predicted 898
10 SASI_Rn02_00264775 predicted 830
11 SASI_Rn01_00089087 predicted 819
12 SASI_Rn01_00089088 predicted 1120
13 SASI_Rn01_00089089 predicted 1062
14 SASI_Rn01_00089090 predicted 226
15 SASI_Rn01_00089091 predicted 375
16 SASI_Rn01_00089092 predicted 815
17 SASI_Rn01_00089095 predicted 1058
18 SASI_Rn01_00089096 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084815 predicted 1187
2 SASI_Mm01_00084817 predicted 1097
3 SASI_Mm01_00084818 predicted 762
4 SASI_Mm01_00084819 predicted 1401
5 SASI_Mm01_00084820 predicted 1014
6 SASI_Mm01_00084822 predicted 915
7 SASI_Mm02_00320773 predicted 1131
8 SASI_Mm02_00320774 predicted 1385
9 SASI_Mm01_00084823 predicted 1047
10 SASI_Mm01_00084824 predicted 928
11 SASI_Mm01_00084816 predicted 1147
12 SASI_Mm01_00084821 predicted 1408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011485
STAR MISSION shRNA Bacterial Glycerol Stock
steroidogenic acute regulatory protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011485.4-909s21c1
Sequence:CCGGTAAGGACTGTCCACCACATTGCTCGAGCAATGTGGTGGACAGTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011485.4-436s21c1
Sequence:CCGGAGCCCATGGACAGACTCTATGCTCGAGCATAGAGTCTGTCCATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011485.4-1111s21c1
Sequence:CCGGGCTAAGGGATAAGTAGCTATGCTCGAGCATAGCTACTTATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011485.4-1135s21c1
Sequence:CCGGCCTTTCATCTAGGCTTGTATACTCGAGTATACAAGCCTAGATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-94s1c1
Sequence:CCGGCCTATAGACATATGCGGAATACTCGAGTATTCCGCATATGTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011485.3-1412s1c1
Sequence:CCGGCCCATGACAATAAAGAACATACTCGAGTATGTTCTTTATTGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-497s1c1
Sequence:CCGGCCCAAATGTCAAGGAGATCAACTCGAGTTGATCTCCTTGACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-776s1c1
Sequence:CCGGGCTGCTCAGTATTGACCTGAACTCGAGTTCAGGTCAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-754s1c1
Sequence:CCGGCCTCCAAGACTAAACTCACTTCTCGAGAAGTGAGTTTAGTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011485
STAR MISSION shRNA shRNA Plasmid DNA
steroidogenic acute regulatory protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011485.4-909s21c1
Sequence:CCGGTAAGGACTGTCCACCACATTGCTCGAGCAATGTGGTGGACAGTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011485.4-436s21c1
Sequence:CCGGAGCCCATGGACAGACTCTATGCTCGAGCATAGAGTCTGTCCATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011485.4-1111s21c1
Sequence:CCGGGCTAAGGGATAAGTAGCTATGCTCGAGCATAGCTACTTATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011485.4-1135s21c1
Sequence:CCGGCCTTTCATCTAGGCTTGTATACTCGAGTATACAAGCCTAGATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-94s1c1
Sequence:CCGGCCTATAGACATATGCGGAATACTCGAGTATTCCGCATATGTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011485.3-1412s1c1
Sequence:CCGGCCCATGACAATAAAGAACATACTCGAGTATGTTCTTTATTGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-497s1c1
Sequence:CCGGCCCAAATGTCAAGGAGATCAACTCGAGTTGATCTCCTTGACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-776s1c1
Sequence:CCGGGCTGCTCAGTATTGACCTGAACTCGAGTTCAGGTCAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-754s1c1
Sequence:CCGGCCTCCAAGACTAAACTCACTTCTCGAGAAGTGAGTTTAGTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011485
STAR MISSION shRNA Lentiviral Transduction Particles
steroidogenic acute regulatory protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011485.4-909s21c1
Sequence:CCGGTAAGGACTGTCCACCACATTGCTCGAGCAATGTGGTGGACAGTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011485.4-436s21c1
Sequence:CCGGAGCCCATGGACAGACTCTATGCTCGAGCATAGAGTCTGTCCATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011485.4-1111s21c1
Sequence:CCGGGCTAAGGGATAAGTAGCTATGCTCGAGCATAGCTACTTATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011485.4-1135s21c1
Sequence:CCGGCCTTTCATCTAGGCTTGTATACTCGAGTATACAAGCCTAGATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-94s1c1
Sequence:CCGGCCTATAGACATATGCGGAATACTCGAGTATTCCGCATATGTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011485.3-1412s1c1
Sequence:CCGGCCCATGACAATAAAGAACATACTCGAGTATGTTCTTTATTGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-497s1c1
Sequence:CCGGCCCAAATGTCAAGGAGATCAACTCGAGTTGATCTCCTTGACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-776s1c1
Sequence:CCGGGCTGCTCAGTATTGACCTGAACTCGAGTTCAGGTCAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011485.3-754s1c1
Sequence:CCGGCCTCCAAGACTAAACTCACTTCTCGAGAAGTGAGTTTAGTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000349
STAR MISSION shRNA Bacterial Glycerol Stock
steroidogenic acute regulatory protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000349.2-987s21c1
Sequence:CCGGGCTACTCAGCATCGACCTCAACTCGAGTTGAGGTCGATGCTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000349.2-1306s21c1
Sequence:CCGGGGATGAGGCTCTTGGATTAAACTCGAGTTTAATCCAAGAGCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000349.2-729s21c1
Sequence:CCGGGGTCCTGCAGAAGATCGGAAACTCGAGTTTCCGATCTTCTGCAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-876s1c1
Sequence:CCGGGCTGCCCAAGAGCATCATCAACTCGAGTTGATGATGCTCTTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-262s1c1
Sequence:CCGGAGCACGTGGATTAACCAGGTTCTCGAGAACCTGGTTAATCCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-448s1c1
Sequence:CCGGGTGATGAGTAAAGTGGTCCCACTCGAGTGGGACCACTTTACTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-165s1c1
Sequence:CCGGCTACAGACACATGCGCAACATCTCGAGATGTTGCGCATGTGTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-823s1c1
Sequence:CCGGAGTCCCTCTAAGACCAAACTTCTCGAGAAGTTTGGTCTTAGAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000349
STAR MISSION shRNA shRNA Plasmid DNA
steroidogenic acute regulatory protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000349.2-987s21c1
Sequence:CCGGGCTACTCAGCATCGACCTCAACTCGAGTTGAGGTCGATGCTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000349.2-1306s21c1
Sequence:CCGGGGATGAGGCTCTTGGATTAAACTCGAGTTTAATCCAAGAGCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000349.2-729s21c1
Sequence:CCGGGGTCCTGCAGAAGATCGGAAACTCGAGTTTCCGATCTTCTGCAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-876s1c1
Sequence:CCGGGCTGCCCAAGAGCATCATCAACTCGAGTTGATGATGCTCTTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-262s1c1
Sequence:CCGGAGCACGTGGATTAACCAGGTTCTCGAGAACCTGGTTAATCCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-448s1c1
Sequence:CCGGGTGATGAGTAAAGTGGTCCCACTCGAGTGGGACCACTTTACTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-165s1c1
Sequence:CCGGCTACAGACACATGCGCAACATCTCGAGATGTTGCGCATGTGTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-823s1c1
Sequence:CCGGAGTCCCTCTAAGACCAAACTTCTCGAGAAGTTTGGTCTTAGAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000349
STAR MISSION shRNA Lentiviral Transduction Particles
steroidogenic acute regulatory protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000349.2-987s21c1
Sequence:CCGGGCTACTCAGCATCGACCTCAACTCGAGTTGAGGTCGATGCTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000349.2-1306s21c1
Sequence:CCGGGGATGAGGCTCTTGGATTAAACTCGAGTTTAATCCAAGAGCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000349.2-729s21c1
Sequence:CCGGGGTCCTGCAGAAGATCGGAAACTCGAGTTTCCGATCTTCTGCAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-876s1c1
Sequence:CCGGGCTGCCCAAGAGCATCATCAACTCGAGTTGATGATGCTCTTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-262s1c1
Sequence:CCGGAGCACGTGGATTAACCAGGTTCTCGAGAACCTGGTTAATCCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-448s1c1
Sequence:CCGGGTGATGAGTAAAGTGGTCCCACTCGAGTGGGACCACTTTACTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-165s1c1
Sequence:CCGGCTACAGACACATGCGCAACATCTCGAGATGTTGCGCATGTGTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000349.1-823s1c1
Sequence:CCGGAGTCCCTCTAAGACCAAACTTCTCGAGAAGTTTGGTCTTAGAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks