EMAIL THIS PAGE TO A FRIEND

STARD10

StAR-related lipid transfer (START) domain containing 10

Synonyms: NY-CO-28 PCTP2 SDCCAG28
UniProtKB ID: Q9Y365, O60532
Gene ID:
Mouse(56018) START domain containing 10
Rat(293150) StAR-related lipid transfer (START) domain containing 10
Zebrafish(100001416) START domain containing 10
chicken(427615) StAR-related lipid transfer (START) domain containing 10
domestic cat(101094876) StAR-related lipid transfer (START) domain containing 10
dog(100686182) StAR-related lipid transfer (START) domain containing 10
naked mole-rat(101723431) StAR-related lipid transfer (START) domain containing 10
domestic guinea pig(100731162) StAR-related lipid transfer (START) domain containing 10
cow(514624) StAR-related lipid transfer (START) domain containing 10
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006645 Rosetta Predictions human pricing
NM_001013069 Rosetta Predictions rat pricing
NM_019990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342009 predicted 1378
2 SASI_Hs01_00037459 predicted 1179
3 SASI_Hs01_00037461 predicted 1233
4 SASI_Hs02_00342010 predicted 1400
5 SASI_Hs01_00037463 predicted 1204
6 SASI_Hs01_00037465 predicted 1260
7 SASI_Hs01_00037466 predicted 1312
8 SASI_Hs02_00342011 predicted 1573
9 SASI_Hs02_00342012 predicted 1469
10 SASI_Hs02_00342013 predicted 1377
11 SASI_Hs01_00037460 predicted 337
12 SASI_Hs01_00037462 predicted 719
13 SASI_Hs01_00037464 predicted 337
14 SASI_Hs01_00037467 predicted 1075
15 SASI_Hs01_00037468 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200696 predicted 413
2 SASI_Rn02_00200697 predicted 532
3 SASI_Rn02_00200698 predicted 479
4 SASI_Rn01_00096306 predicted 803
5 SASI_Rn02_00200699 predicted 455
6 SASI_Rn01_00096307 predicted 654
7 SASI_Rn02_00200700 predicted 527
8 SASI_Rn02_00200701 predicted 392
9 SASI_Rn01_00096309 predicted 739
10 SASI_Rn01_00096311 predicted 580
11 SASI_Rn01_00096308 predicted 651
12 SASI_Rn01_00096310 predicted 877
13 SASI_Rn01_00096312 predicted 973
14 SASI_Rn01_00096313 predicted 838
15 SASI_Rn01_00096314 predicted 840
16 SASI_Rn01_00096315 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147866 predicted 461
2 SASI_Mm01_00147867 predicted 441
3 SASI_Mm01_00147868 predicted 741
4 SASI_Mm01_00147869 predicted 903
5 SASI_Mm01_00147870 predicted 584
6 SASI_Mm01_00147871 predicted 333
7 SASI_Mm01_00147872 predicted 589
8 SASI_Mm01_00147873 predicted 399
9 SASI_Mm01_00147874 predicted 379
10 SASI_Mm01_00147875 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019990
VALIDATED
STARD10 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019990.1-744s1c1
Sequence:CCGGCGCTGATTACATCATTATGAACTCGAGTTCATAATGATGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-598s1c1
Sequence:CCGGAGAAAGAAGTGGGACAGTAATCTCGAGATTACTGTCCCACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-767s1c1
Sequence:CCGGACTCAGTGAAACACCCTAAATCTCGAGATTTAGGGTGTTTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019990.1-696s1c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-582s1c1
Sequence:CCGGGCATGACATAGAATACAGAAACTCGAGTTTCTGTATTCTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-519s21c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-567s21c1
Sequence:CCGGCGCTGATTACATCATTATGAACTCGAGTTCATAATGATGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-405s21c1
Sequence:CCGGGCATGACATAGAATACAGAAACTCGAGTTTCTGTATTCTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-421s21c1
Sequence:CCGGAGAAAGAAGTGGGACAGTAATCTCGAGATTACTGTCCCACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-590s21c1
Sequence:CCGGACTCAGTGAAACACCCTAAATCTCGAGATTTAGGGTGTTTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019990
VALIDATED
STARD10 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019990.1-744s1c1
Sequence:CCGGCGCTGATTACATCATTATGAACTCGAGTTCATAATGATGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-598s1c1
Sequence:CCGGAGAAAGAAGTGGGACAGTAATCTCGAGATTACTGTCCCACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-767s1c1
Sequence:CCGGACTCAGTGAAACACCCTAAATCTCGAGATTTAGGGTGTTTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019990.1-696s1c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-582s1c1
Sequence:CCGGGCATGACATAGAATACAGAAACTCGAGTTTCTGTATTCTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-519s21c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-567s21c1
Sequence:CCGGCGCTGATTACATCATTATGAACTCGAGTTCATAATGATGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-405s21c1
Sequence:CCGGGCATGACATAGAATACAGAAACTCGAGTTTCTGTATTCTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-421s21c1
Sequence:CCGGAGAAAGAAGTGGGACAGTAATCTCGAGATTACTGTCCCACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-590s21c1
Sequence:CCGGACTCAGTGAAACACCCTAAATCTCGAGATTTAGGGTGTTTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019990
VALIDATED
STARD10 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019990.1-744s1c1
Sequence:CCGGCGCTGATTACATCATTATGAACTCGAGTTCATAATGATGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-598s1c1
Sequence:CCGGAGAAAGAAGTGGGACAGTAATCTCGAGATTACTGTCCCACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-767s1c1
Sequence:CCGGACTCAGTGAAACACCCTAAATCTCGAGATTTAGGGTGTTTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019990.1-696s1c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019990.1-582s1c1
Sequence:CCGGGCATGACATAGAATACAGAAACTCGAGTTTCTGTATTCTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-519s21c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-567s21c1
Sequence:CCGGCGCTGATTACATCATTATGAACTCGAGTTCATAATGATGTAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-405s21c1
Sequence:CCGGGCATGACATAGAATACAGAAACTCGAGTTTCTGTATTCTATGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-421s21c1
Sequence:CCGGAGAAAGAAGTGGGACAGTAATCTCGAGATTACTGTCCCACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019990.4-590s21c1
Sequence:CCGGACTCAGTGAAACACCCTAAATCTCGAGATTTAGGGTGTTTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006645
VALIDATED
STARD10 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006645.1-1066s1c1
Sequence:CCGGCCCAAGTGGGTGGTGAATAAACTCGAGTTTATTCACCACCCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-741s1c1
Sequence:CCGGCGACATTGAGTACCGCAAGAACTCGAGTTCTTGCGGTACTCAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-732s1c1
Sequence:CCGGCGTCCTACACGACATTGAGTACTCGAGTACTCAATGTCGTGTAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-759s1c1
Sequence:CCGGGAAATGGGACAGCAACGTCATCTCGAGATGACGTTGCTGTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-852s1c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006645.1-768s1c1
Sequence:CCGGCAGCAACGTCATTGAGACTTTCTCGAGAAAGTCTCAATGACGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006645.1-1107s1c1
Sequence:CCGGCAAGGCCATGAAGAAGATGTACTCGAGTACATCTTCTTCATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1711s21c1
Sequence:CCGGATGCGGACTCACTGGAGAACACTCGAGTGTTCTCCAGTGAGTCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1389s21c1
Sequence:CCGGTCAGTCAAACATCCCAAATACCTCGAGGTATTTGGGATGTTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1274s21c1
Sequence:CCGGCAACGCTGACGTGGGCTATTACTCGAGTAATAGCCCACGTCAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006645
VALIDATED
STARD10 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006645.1-1066s1c1
Sequence:CCGGCCCAAGTGGGTGGTGAATAAACTCGAGTTTATTCACCACCCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-741s1c1
Sequence:CCGGCGACATTGAGTACCGCAAGAACTCGAGTTCTTGCGGTACTCAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-732s1c1
Sequence:CCGGCGTCCTACACGACATTGAGTACTCGAGTACTCAATGTCGTGTAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-759s1c1
Sequence:CCGGGAAATGGGACAGCAACGTCATCTCGAGATGACGTTGCTGTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-852s1c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006645.1-768s1c1
Sequence:CCGGCAGCAACGTCATTGAGACTTTCTCGAGAAAGTCTCAATGACGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006645.1-1107s1c1
Sequence:CCGGCAAGGCCATGAAGAAGATGTACTCGAGTACATCTTCTTCATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1711s21c1
Sequence:CCGGATGCGGACTCACTGGAGAACACTCGAGTGTTCTCCAGTGAGTCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1389s21c1
Sequence:CCGGTCAGTCAAACATCCCAAATACCTCGAGGTATTTGGGATGTTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1274s21c1
Sequence:CCGGCAACGCTGACGTGGGCTATTACTCGAGTAATAGCCCACGTCAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006645
VALIDATED
STARD10 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006645.1-1066s1c1
Sequence:CCGGCCCAAGTGGGTGGTGAATAAACTCGAGTTTATTCACCACCCACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-741s1c1
Sequence:CCGGCGACATTGAGTACCGCAAGAACTCGAGTTCTTGCGGTACTCAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-732s1c1
Sequence:CCGGCGTCCTACACGACATTGAGTACTCGAGTACTCAATGTCGTGTAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-759s1c1
Sequence:CCGGGAAATGGGACAGCAACGTCATCTCGAGATGACGTTGCTGTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006645.1-852s1c1
Sequence:CCGGCCTGAAGAACCGTGATGTCATCTCGAGATGACATCACGGTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006645.1-768s1c1
Sequence:CCGGCAGCAACGTCATTGAGACTTTCTCGAGAAAGTCTCAATGACGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006645.1-1107s1c1
Sequence:CCGGCAAGGCCATGAAGAAGATGTACTCGAGTACATCTTCTTCATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1711s21c1
Sequence:CCGGATGCGGACTCACTGGAGAACACTCGAGTGTTCTCCAGTGAGTCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1389s21c1
Sequence:CCGGTCAGTCAAACATCCCAAATACCTCGAGGTATTTGGGATGTTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006645.2-1274s21c1
Sequence:CCGGCAACGCTGACGTGGGCTATTACTCGAGTAATAGCCCACGTCAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks