EMAIL THIS PAGE TO A FRIEND

STARD13

StAR-related lipid transfer (START) domain containing 13

Synonyms: ARHGAP37 DLC2 GT650 LINC00464
Gene ID:
Human(90627) Summary: This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(243362) StAR-related lipid transfer (START) domain containing 13
Rat(498130) StAR-related lipid transfer (START) domain containing 13
cow(538697) StAR-related lipid transfer (START) domain containing 13
sheep(101108664) StAR-related lipid transfer (START) domain containing 13
domestic guinea pig(100724328) StAR-related lipid transfer (START) domain containing 13
naked mole-rat(101723739) StAR-related lipid transfer (START) domain containing 13
Domestic Rabbit(100338528) StAR-related lipid transfer (START) domain containing 13
chicken(418908) StAR-related lipid transfer (START) domain containing 13
dog(477311) StAR-related lipid transfer (START) domain containing 13
Horse(100062290) StAR-related lipid transfer (START) domain containing 13
domestic cat(101081186) StAR-related lipid transfer (START) domain containing 13
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052851 Rosetta Predictions human pricing
NM_178006 Rosetta Predictions human pricing
NM_178007 Rosetta Predictions human pricing
NM_178008 Rosetta Predictions human pricing
NM_001109060 Rosetta Predictions rat pricing
NM_146258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042482 predicted 1957
2 SASI_Hs01_00042483 predicted 1588
3 SASI_Hs01_00042484 predicted 2290
4 SASI_Hs02_00361538 predicted 2594
5 SASI_Hs01_00042485 predicted 2200
6 SASI_Hs01_00042487 predicted 3227
7 SASI_Hs02_00361539 predicted 1640
8 SASI_Hs01_00042489 predicted 1600
9 SASI_Hs01_00042490 predicted 2127
10 SASI_Hs01_00042491 predicted 431
11 SASI_Hs01_00042486 predicted 2476
12 SASI_Hs01_00042488 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027876 predicted 2060
2 SASI_Hs01_00027877 predicted 1683
3 SASI_Hs01_00027878 predicted 2386
4 SASI_Hs02_00369477 predicted 2692
5 SASI_Hs01_00027879 predicted 2301
6 SASI_Hs01_00027881 predicted 3321
7 SASI_Hs02_00369478 predicted 1740
8 SASI_Hs01_00027883 predicted 1700
9 SASI_Hs01_00027884 predicted 2226
10 SASI_Hs01_00027885 predicted 538
11 SASI_Hs01_00027880 predicted 2582
12 SASI_Hs01_00027882 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159113 predicted 1982
2 SASI_Hs01_00159114 predicted 1616
3 SASI_Hs01_00159115 predicted 2318
4 SASI_Hs02_00369479 predicted 2622
5 SASI_Hs01_00159116 predicted 2223
6 SASI_Hs01_00159118 predicted 3255
7 SASI_Hs02_00369480 predicted 1667
8 SASI_Hs01_00159120 predicted 1626
9 SASI_Hs01_00159121 predicted 2156
10 SASI_Hs01_00159122 predicted 459
11 SASI_Hs01_00159117 predicted 2508
12 SASI_Hs01_00159119 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211768 predicted 203
2 SASI_Hs01_00211769 predicted 203
3 SASI_Hs01_00211770 predicted 259
4 SASI_Hs01_00211771 predicted 258
5 SASI_Hs01_00211772 predicted 238
6 SASI_Hs01_00211773 predicted 251
7 SASI_Hs01_00211774 predicted 214
8 SASI_Hs01_00211775 predicted 220
9 SASI_Hs01_00211776 predicted 227
10 SASI_Hs01_00211777 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244730 predicted 451
2 SASI_Rn02_00244731 predicted 2211
3 SASI_Rn02_00244732 predicted 1557
4 SASI_Rn02_00244733 predicted 2292
5 SASI_Rn02_00244734 predicted 2282
6 SASI_Rn02_00244735 predicted 3393
7 SASI_Rn02_00244736 predicted 2045
8 SASI_Rn02_00244737 predicted 2150
9 SASI_Rn02_00244738 predicted 2690
10 SASI_Rn02_00244739 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072839 predicted 2752
2 SASI_Mm01_00072840 predicted 455
3 SASI_Mm01_00072841 predicted 3273
4 SASI_Mm02_00342001 predicted 423
5 SASI_Mm01_00072842 predicted 2700
6 SASI_Mm01_00072843 predicted 2147
7 SASI_Mm01_00072844 predicted 1171
8 SASI_Mm01_00072845 predicted 2227
9 SASI_Mm01_00072846 predicted 733
10 SASI_Mm01_00072847 predicted 2271
11 SASI_Mm01_00072848 predicted 1405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052851
VALIDATED
STARD13 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052851.2-3498s21c1
Sequence:CCGGGAACTGAAGGACGCGGTTAATCTCGAGATTAACCGCGTCCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052851.2-2245s21c1
Sequence:CCGGGCTTATGATGTGGCGGATATGCTCGAGCATATCCGCCACATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052851.2-3598s21c1
Sequence:CCGGTGGCTACATCCCTACTAATATCTCGAGATATTAGTAGGGATGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-2466s1c1
Sequence:CCGGCCTCCCTCTTTCATCTTAATTCTCGAGAATTAAGATGAAAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-1661s1c1
Sequence:CCGGCCCAGTGATGTGGAAAGAGATCTCGAGATCTCTTTCCACATCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052851.1-901s1c1
Sequence:CCGGGCCAGAGTCCTTTAAGGCTATCTCGAGATAGCCTTAAAGGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052851.1-3291s1c1
Sequence:CCGGCAGCAGAAGTTGCCAGGATTACTCGAGTAATCCTGGCAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-1239s1c1
Sequence:CCGGCCAAGGCACTTTCTATTGAAACTCGAGTTTCAATAGAAAGTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052851
VALIDATED
STARD13 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052851.2-3498s21c1
Sequence:CCGGGAACTGAAGGACGCGGTTAATCTCGAGATTAACCGCGTCCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052851.2-2245s21c1
Sequence:CCGGGCTTATGATGTGGCGGATATGCTCGAGCATATCCGCCACATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052851.2-3598s21c1
Sequence:CCGGTGGCTACATCCCTACTAATATCTCGAGATATTAGTAGGGATGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-2466s1c1
Sequence:CCGGCCTCCCTCTTTCATCTTAATTCTCGAGAATTAAGATGAAAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-1661s1c1
Sequence:CCGGCCCAGTGATGTGGAAAGAGATCTCGAGATCTCTTTCCACATCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052851.1-901s1c1
Sequence:CCGGGCCAGAGTCCTTTAAGGCTATCTCGAGATAGCCTTAAAGGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052851.1-3291s1c1
Sequence:CCGGCAGCAGAAGTTGCCAGGATTACTCGAGTAATCCTGGCAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-1239s1c1
Sequence:CCGGCCAAGGCACTTTCTATTGAAACTCGAGTTTCAATAGAAAGTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052851
VALIDATED
STARD13 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052851.2-3498s21c1
Sequence:CCGGGAACTGAAGGACGCGGTTAATCTCGAGATTAACCGCGTCCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052851.2-2245s21c1
Sequence:CCGGGCTTATGATGTGGCGGATATGCTCGAGCATATCCGCCACATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052851.2-3598s21c1
Sequence:CCGGTGGCTACATCCCTACTAATATCTCGAGATATTAGTAGGGATGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-2466s1c1
Sequence:CCGGCCTCCCTCTTTCATCTTAATTCTCGAGAATTAAGATGAAAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-1661s1c1
Sequence:CCGGCCCAGTGATGTGGAAAGAGATCTCGAGATCTCTTTCCACATCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052851.1-901s1c1
Sequence:CCGGGCCAGAGTCCTTTAAGGCTATCTCGAGATAGCCTTAAAGGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052851.1-3291s1c1
Sequence:CCGGCAGCAGAAGTTGCCAGGATTACTCGAGTAATCCTGGCAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052851.1-1239s1c1
Sequence:CCGGCCAAGGCACTTTCTATTGAAACTCGAGTTTCAATAGAAAGTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146258
STARD13 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 13
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146258.1-4011s1c1
Sequence:CCGGGCCTCTTATTTCTGATGTTTACTCGAGTAAACATCAGAAATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-3383s1c1
Sequence:CCGGCGGCAGAAGTTACCAGAATTACTCGAGTAATTCTGGTAACTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-180s1c1
Sequence:CCGGCCAGGAGATGTACTTGCGATTCTCGAGAATCGCAAGTACATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-884s1c1
Sequence:CCGGCCTTTCTGAAACGCATGGATACTCGAGTATCCATGCGTTTCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146258
STARD13 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 13
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146258.1-4011s1c1
Sequence:CCGGGCCTCTTATTTCTGATGTTTACTCGAGTAAACATCAGAAATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-3383s1c1
Sequence:CCGGCGGCAGAAGTTACCAGAATTACTCGAGTAATTCTGGTAACTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-180s1c1
Sequence:CCGGCCAGGAGATGTACTTGCGATTCTCGAGAATCGCAAGTACATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-884s1c1
Sequence:CCGGCCTTTCTGAAACGCATGGATACTCGAGTATCCATGCGTTTCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146258
STARD13 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 13
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146258.1-4011s1c1
Sequence:CCGGGCCTCTTATTTCTGATGTTTACTCGAGTAAACATCAGAAATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-3383s1c1
Sequence:CCGGCGGCAGAAGTTACCAGAATTACTCGAGTAATTCTGGTAACTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-180s1c1
Sequence:CCGGCCAGGAGATGTACTTGCGATTCTCGAGAATCGCAAGTACATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146258.1-884s1c1
Sequence:CCGGCCTTTCTGAAACGCATGGATACTCGAGTATCCATGCGTTTCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks