EMAIL THIS PAGE TO A FRIEND

STARD3

StAR-related lipid transfer (START) domain containing 3

Synonyms: CAB1 MLN64 es64
UniProtKB ID: Q14849, A8MXA4, B4DUY1, F5H0G2, Q53Y53, Q96HM9
Gene ID:
Human(10948) Summary: This gene encodes a member of a subfamily of lipid trafficking proteins that are characterized by a C-terminal steroidogenic acute regulatory domain and an N-terminal metastatic lymph node 64 domain. The encoded protein localizes to the membranes of late endosomes and may be involved in exporting cholesterol. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Mouse(59045) START domain containing 3
Rat(363675) StAR-related lipid transfer (START) domain containing 3
Zebrafish(63998) START domain containing 3
chicken(770436) StAR-related lipid transfer (START) domain containing 3
Horse(100054870) StAR-related lipid transfer (START) domain containing 3
domestic cat(101091233) StAR-related lipid transfer (START) domain containing 3
dog(491024) StAR-related lipid transfer (START) domain containing 3
Domestic Rabbit(100354978) StAR-related lipid transfer (START) domain containing 3
naked mole-rat(101706927) StAR-related lipid transfer (START) domain containing 3
domestic guinea pig(100727101) StAR-related lipid transfer (START) domain containing 3
cow(511267) StAR-related lipid transfer (START) domain containing 3
sheep(101103332) StAR-related lipid transfer (START) domain containing 3
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006804 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006804 Rosetta Predictions human pricing
NM_001014229 Rosetta Predictions rat pricing
NM_021547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206574 predicted 966
2 SASI_Hs01_00206575 predicted 1318
3 SASI_Hs01_00206576 predicted 950
4 SASI_Hs01_00206578 predicted 1330
5 SASI_Hs01_00206579 predicted 663
6 SASI_Hs01_00206580 predicted 756
7 SASI_Hs01_00206581 predicted 771
8 SASI_Hs02_00342324 predicted 932
9 SASI_Hs01_00206582 predicted 649
10 SASI_Hs01_00206583 predicted 1194
11 SASI_Hs01_00206577 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114717 predicted 499
2 SASI_Rn01_00114718 predicted 1372
3 SASI_Rn01_00114719 predicted 1506
4 SASI_Rn01_00114721 predicted 686
5 SASI_Rn02_00201768 predicted 648
6 SASI_Rn01_00114722 predicted 906
7 SASI_Rn01_00114723 predicted 1526
8 SASI_Rn01_00114724 predicted 697
9 SASI_Rn01_00114725 predicted 1180
10 SASI_Rn02_00201769 predicted 1184
11 SASI_Rn01_00114720 predicted 880
12 SASI_Rn01_00114726 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132771 predicted 823
2 SASI_Mm01_00132772 predicted 1601
3 SASI_Mm01_00132773 predicted 1590
4 SASI_Mm01_00132774 predicted 980
5 SASI_Mm01_00132775 predicted 882
6 SASI_Mm01_00132776 predicted 1158
7 SASI_Mm01_00132777 predicted 706
8 SASI_Mm01_00132778 predicted 1215
9 SASI_Mm01_00132779 predicted 812
10 SASI_Mm02_00326301 predicted 995
11 SASI_Mm01_00132770 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006804
STARD3 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-961s1c1
Sequence:CCGGCGGCAAGACGTTTATCCTGAACTCGAGTTCAGGATAAACGTCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006804.2-1319s1c1
Sequence:CCGGGTTTGCACCTTTGTCTGGATTCTCGAGAATCCAGACAAAGGTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-377s1c1
Sequence:CCGGGAGATCATCCAGTACAACTTTCTCGAGAAAGTTGTACTGGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-516s1c1
Sequence:CCGGCCAGTGCATTCCTCATTGTCACTCGAGTGACAATGAGGAATGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-887s1c1
Sequence:CCGGCAGGAAGAGAACTGGAAGTTTCTCGAGAAACTTCCAGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-619s1c1
Sequence:CCGGGACCTGGTTCCTTGACTTCAACTCGAGTTGAAGTCAAGGAACCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006804
STARD3 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-961s1c1
Sequence:CCGGCGGCAAGACGTTTATCCTGAACTCGAGTTCAGGATAAACGTCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006804.2-1319s1c1
Sequence:CCGGGTTTGCACCTTTGTCTGGATTCTCGAGAATCCAGACAAAGGTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-377s1c1
Sequence:CCGGGAGATCATCCAGTACAACTTTCTCGAGAAAGTTGTACTGGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-516s1c1
Sequence:CCGGCCAGTGCATTCCTCATTGTCACTCGAGTGACAATGAGGAATGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-887s1c1
Sequence:CCGGCAGGAAGAGAACTGGAAGTTTCTCGAGAAACTTCCAGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-619s1c1
Sequence:CCGGGACCTGGTTCCTTGACTTCAACTCGAGTTGAAGTCAAGGAACCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006804
STARD3 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-961s1c1
Sequence:CCGGCGGCAAGACGTTTATCCTGAACTCGAGTTCAGGATAAACGTCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006804.2-1319s1c1
Sequence:CCGGGTTTGCACCTTTGTCTGGATTCTCGAGAATCCAGACAAAGGTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-377s1c1
Sequence:CCGGGAGATCATCCAGTACAACTTTCTCGAGAAAGTTGTACTGGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-516s1c1
Sequence:CCGGCCAGTGCATTCCTCATTGTCACTCGAGTGACAATGAGGAATGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-887s1c1
Sequence:CCGGCAGGAAGAGAACTGGAAGTTTCTCGAGAAACTTCCAGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006804.2-619s1c1
Sequence:CCGGGACCTGGTTCCTTGACTTCAACTCGAGTTGAAGTCAAGGAACCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021547
VALIDATED
STARD3 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1568s1c1
Sequence:CCGGAGCCAGAAAGTGGAACTGTTTCTCGAGAAACAGTTCCACTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021547.1-378s1c1
Sequence:CCGGCTCTGGATCATCGAGCTAAATCTCGAGATTTAGCTCGATGATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1013s1c1
Sequence:CCGGCCATGGCAAGACCTTCATCTTCTCGAGAAGATGAAGGTCTTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-377s1c1
Sequence:CCGGTCTCTGGATCATCGAGCTAAACTCGAGTTTAGCTCGATGATCCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1386s1c1
Sequence:CCGGGTCTGGATTCTTAACACAGATCTCGAGATCTGTGTTAAGAATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021547
VALIDATED
STARD3 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1568s1c1
Sequence:CCGGAGCCAGAAAGTGGAACTGTTTCTCGAGAAACAGTTCCACTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021547.1-378s1c1
Sequence:CCGGCTCTGGATCATCGAGCTAAATCTCGAGATTTAGCTCGATGATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1013s1c1
Sequence:CCGGCCATGGCAAGACCTTCATCTTCTCGAGAAGATGAAGGTCTTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-377s1c1
Sequence:CCGGTCTCTGGATCATCGAGCTAAACTCGAGTTTAGCTCGATGATCCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1386s1c1
Sequence:CCGGGTCTGGATTCTTAACACAGATCTCGAGATCTGTGTTAAGAATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021547
VALIDATED
STARD3 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1568s1c1
Sequence:CCGGAGCCAGAAAGTGGAACTGTTTCTCGAGAAACAGTTCCACTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021547.1-378s1c1
Sequence:CCGGCTCTGGATCATCGAGCTAAATCTCGAGATTTAGCTCGATGATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1013s1c1
Sequence:CCGGCCATGGCAAGACCTTCATCTTCTCGAGAAGATGAAGGTCTTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-377s1c1
Sequence:CCGGTCTCTGGATCATCGAGCTAAACTCGAGTTTAGCTCGATGATCCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021547.1-1386s1c1
Sequence:CCGGGTCTGGATTCTTAACACAGATCTCGAGATCTGTGTTAAGAATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks