EMAIL THIS PAGE TO A FRIEND

STARD3NL

STARD3 N-terminal like

Synonyms: MENTHO
UniProtKB ID: O95772
Gene ID:
Human(83930) Summary: This gene encodes a late-endosomal protein that contains a conserved MENTAL (MLN64 N-terminal) domain. The encoded protein binds cholesterol molecules and may play a role in endosomal cholesterol transport through interactions with metastatic lymph node protein 64 (MLN64). [provided by RefSeq, Sep 2011]
Mouse(76205) STARD3 N-terminal like
Rat(291182) STARD3 N-terminal like
cow(510042) STARD3 N-terminal like
sheep(101108381) STARD3 N-terminal like
domestic guinea pig(100717466) STARD3 N-terminal like
naked mole-rat(101712441) STARD3 N-terminal like
Zebrafish(436592) STARD3 N-terminal like
dog(483257) STARD3 N-terminal like
domestic cat(101092753) STARD3 N-terminal like
chicken(420730) STARD3 N-terminal like
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019204 Anti-STARD3NL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032016 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032016 Rosetta Predictions human pricing
NM_001008298 Rosetta Predictions rat pricing
NM_024270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197476 predicted 882
2 SASI_Hs01_00197477 predicted 253
3 SASI_Hs01_00197478 predicted 355
4 SASI_Hs01_00197479 predicted 410
5 SASI_Hs01_00197480 predicted 730
6 SASI_Hs01_00197481 predicted 378
7 SASI_Hs01_00197482 predicted 342
8 SASI_Hs01_00197483 predicted 601
9 SASI_Hs01_00197484 predicted 318
10 SASI_Hs01_00197485 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114024 predicted 387
2 SASI_Rn02_00199001 predicted 389
3 SASI_Rn01_00114025 predicted 381
4 SASI_Rn01_00114026 predicted 298
5 SASI_Rn01_00114027 predicted 563
6 SASI_Rn01_00114028 predicted 245
7 SASI_Rn02_00199002 predicted 894
8 SASI_Rn01_00114029 predicted 279
9 SASI_Rn01_00114030 predicted 303
10 SASI_Rn01_00114031 predicted 441
11 SASI_Rn01_00114032 predicted 454
12 SASI_Rn01_00114033 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179711 predicted 357
2 SASI_Mm01_00179712 predicted 390
3 SASI_Mm01_00179713 predicted 381
4 SASI_Mm01_00179714 predicted 213
5 SASI_Mm01_00179715 predicted 304
6 SASI_Mm01_00179717 predicted 562
7 SASI_Mm01_00179718 predicted 307
8 SASI_Mm02_00327672 predicted 271
9 SASI_Mm01_00179719 predicted 283
10 SASI_Mm01_00179720 predicted 362
11 SASI_Mm01_00179716 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024270
VALIDATED
STARD3NL MISSION shRNA Bacterial Glycerol Stock
STARD3 N-terminal like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-210s1c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-282s1c1
Sequence:CCGGGTCACCTTTGACCTCTTATTTCTCGAGAAATAAGAGGTCAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-426s1c1
Sequence:CCGGCGATTCAAAGTGCTGATACTTCTCGAGAAGTATCAGCACTTTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-1021s1c1
Sequence:CCGGCGGTCTGACCTGATAATGAATCTCGAGATTCATTATCAGGTCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-505s1c1
Sequence:CCGGCCAGTGCCTTTCTATTAGCAACTCGAGTTGCTAATAGAAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-210s21c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-282s21c1
Sequence:CCGGGTCACCTTTGACCTCTTATTTCTCGAGAAATAAGAGGTCAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-426s21c1
Sequence:CCGGCGATTCAAAGTGCTGATACTTCTCGAGAAGTATCAGCACTTTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-505s21c1
Sequence:CCGGCCAGTGCCTTTCTATTAGCAACTCGAGTTGCTAATAGAAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-1021s21c1
Sequence:CCGGCGGTCTGACCTGATAATGAATCTCGAGATTCATTATCAGGTCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024270
VALIDATED
STARD3NL MISSION shRNA shRNA Plasmid DNA
STARD3 N-terminal like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-210s1c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-282s1c1
Sequence:CCGGGTCACCTTTGACCTCTTATTTCTCGAGAAATAAGAGGTCAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-426s1c1
Sequence:CCGGCGATTCAAAGTGCTGATACTTCTCGAGAAGTATCAGCACTTTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-1021s1c1
Sequence:CCGGCGGTCTGACCTGATAATGAATCTCGAGATTCATTATCAGGTCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-505s1c1
Sequence:CCGGCCAGTGCCTTTCTATTAGCAACTCGAGTTGCTAATAGAAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-210s21c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-282s21c1
Sequence:CCGGGTCACCTTTGACCTCTTATTTCTCGAGAAATAAGAGGTCAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-426s21c1
Sequence:CCGGCGATTCAAAGTGCTGATACTTCTCGAGAAGTATCAGCACTTTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-505s21c1
Sequence:CCGGCCAGTGCCTTTCTATTAGCAACTCGAGTTGCTAATAGAAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-1021s21c1
Sequence:CCGGCGGTCTGACCTGATAATGAATCTCGAGATTCATTATCAGGTCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024270
VALIDATED
STARD3NL MISSION shRNA Lentiviral Transduction Particles
STARD3 N-terminal like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-210s1c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-282s1c1
Sequence:CCGGGTCACCTTTGACCTCTTATTTCTCGAGAAATAAGAGGTCAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-426s1c1
Sequence:CCGGCGATTCAAAGTGCTGATACTTCTCGAGAAGTATCAGCACTTTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-1021s1c1
Sequence:CCGGCGGTCTGACCTGATAATGAATCTCGAGATTCATTATCAGGTCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024270.2-505s1c1
Sequence:CCGGCCAGTGCCTTTCTATTAGCAACTCGAGTTGCTAATAGAAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-210s21c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-282s21c1
Sequence:CCGGGTCACCTTTGACCTCTTATTTCTCGAGAAATAAGAGGTCAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-426s21c1
Sequence:CCGGCGATTCAAAGTGCTGATACTTCTCGAGAAGTATCAGCACTTTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-505s21c1
Sequence:CCGGCCAGTGCCTTTCTATTAGCAACTCGAGTTGCTAATAGAAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024270.2-1021s21c1
Sequence:CCGGCGGTCTGACCTGATAATGAATCTCGAGATTCATTATCAGGTCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032016
VALIDATED
STARD3NL MISSION shRNA Bacterial Glycerol Stock
STARD3 N-terminal like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032016.2-251s1c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032016.2-737s1c1
Sequence:CCGGGCACTTATACCTGGTGGTCTTCTCGAGAAGACCACCAGGTATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-964s1c1
Sequence:CCGGGCTGGCTTTATTGAACAGCTACTCGAGTAGCTGTTCAATAAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-1386s1c1
Sequence:CCGGGCATTATGTGTATGGCCTGAACTCGAGTTCAGGCCATACACATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-613s1c1
Sequence:CCGGGCTGCCCATCATTTCATTCATCTCGAGATGAATGAAATGATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-327s1c1
Sequence:CCGGCCTTTGACCTCTTATTCGTAACTCGAGTTACGAATAAGAGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-250s21c1
Sequence:CCGGGGCCAGGATTGAGTCCTATGACTCGAGTCATAGGACTCAATCCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-410s21c1
Sequence:CCGGGTGATGCAGTATGACTACTATCTCGAGATAGTAGTCATACTGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-739s21c1
Sequence:CCGCACTTATACCTGGTGGTCTTTCCTCGAGGAAAGACCACCAGGTATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-293s21c1
Sequence:CCGGTCTGATGTCAGGAGGACTTTCCTCGAGGAAAGTCCTCCTGACATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032016.2-1023s21c1
Sequence:CCGGACCATATCCATGCACATTTAGCTCGAGCTAAATGTGCATGGATATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032016
VALIDATED
STARD3NL MISSION shRNA shRNA Plasmid DNA
STARD3 N-terminal like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032016.2-251s1c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032016.2-737s1c1
Sequence:CCGGGCACTTATACCTGGTGGTCTTCTCGAGAAGACCACCAGGTATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-964s1c1
Sequence:CCGGGCTGGCTTTATTGAACAGCTACTCGAGTAGCTGTTCAATAAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-1386s1c1
Sequence:CCGGGCATTATGTGTATGGCCTGAACTCGAGTTCAGGCCATACACATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-613s1c1
Sequence:CCGGGCTGCCCATCATTTCATTCATCTCGAGATGAATGAAATGATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-327s1c1
Sequence:CCGGCCTTTGACCTCTTATTCGTAACTCGAGTTACGAATAAGAGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-250s21c1
Sequence:CCGGGGCCAGGATTGAGTCCTATGACTCGAGTCATAGGACTCAATCCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-410s21c1
Sequence:CCGGGTGATGCAGTATGACTACTATCTCGAGATAGTAGTCATACTGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-739s21c1
Sequence:CCGCACTTATACCTGGTGGTCTTTCCTCGAGGAAAGACCACCAGGTATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-293s21c1
Sequence:CCGGTCTGATGTCAGGAGGACTTTCCTCGAGGAAAGTCCTCCTGACATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032016.2-1023s21c1
Sequence:CCGGACCATATCCATGCACATTTAGCTCGAGCTAAATGTGCATGGATATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032016
VALIDATED
STARD3NL MISSION shRNA Lentiviral Transduction Particles
STARD3 N-terminal like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032016.2-251s1c1
Sequence:CCGGGCCAGGATTGAGTCCTATGAACTCGAGTTCATAGGACTCAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032016.2-737s1c1
Sequence:CCGGGCACTTATACCTGGTGGTCTTCTCGAGAAGACCACCAGGTATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-964s1c1
Sequence:CCGGGCTGGCTTTATTGAACAGCTACTCGAGTAGCTGTTCAATAAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-1386s1c1
Sequence:CCGGGCATTATGTGTATGGCCTGAACTCGAGTTCAGGCCATACACATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-613s1c1
Sequence:CCGGGCTGCCCATCATTTCATTCATCTCGAGATGAATGAAATGATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032016.2-327s1c1
Sequence:CCGGCCTTTGACCTCTTATTCGTAACTCGAGTTACGAATAAGAGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-250s21c1
Sequence:CCGGGGCCAGGATTGAGTCCTATGACTCGAGTCATAGGACTCAATCCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-410s21c1
Sequence:CCGGGTGATGCAGTATGACTACTATCTCGAGATAGTAGTCATACTGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-739s21c1
Sequence:CCGCACTTATACCTGGTGGTCTTTCCTCGAGGAAAGACCACCAGGTATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032016.2-293s21c1
Sequence:CCGGTCTGATGTCAGGAGGACTTTCCTCGAGGAAAGTCCTCCTGACATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032016.2-1023s21c1
Sequence:CCGGACCATATCCATGCACATTTAGCTCGAGCTAAATGTGCATGGATATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks